ID: 1145245616

View in Genome Browser
Species Human (GRCh38)
Location 17:21267405-21267427
Sequence GAGTGCATGCTGATGGACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145245612_1145245616 -10 Left 1145245612 17:21267392-21267414 CCGCCTTCTCAGGGAGTGCATGC No data
Right 1145245616 17:21267405-21267427 GAGTGCATGCTGATGGACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145245616 Original CRISPR GAGTGCATGCTGATGGACTA GGG Intergenic
No off target data available for this crispr