ID: 1145248249

View in Genome Browser
Species Human (GRCh38)
Location 17:21283857-21283879
Sequence CTGCTGCCCCTGTTCTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145248249_1145248254 18 Left 1145248249 17:21283857-21283879 CCTGTGTAGAACAGGGGCAGCAG No data
Right 1145248254 17:21283898-21283920 CCTCGTGCTGCCTCGTCACCGGG No data
1145248249_1145248252 17 Left 1145248249 17:21283857-21283879 CCTGTGTAGAACAGGGGCAGCAG No data
Right 1145248252 17:21283897-21283919 TCCTCGTGCTGCCTCGTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145248249 Original CRISPR CTGCTGCCCCTGTTCTACAC AGG (reversed) Intergenic
No off target data available for this crispr