ID: 1145251284

View in Genome Browser
Species Human (GRCh38)
Location 17:21298239-21298261
Sequence GGGCCTCCTTCCCCCTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 164}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145251283_1145251284 -9 Left 1145251283 17:21298225-21298247 CCTGCAGGGCTGGTGGGCCTCCT 0: 1
1: 0
2: 2
3: 38
4: 250
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251274_1145251284 15 Left 1145251274 17:21298201-21298223 CCTGGGTCTGTCCTGCTCTGCTC 0: 1
1: 1
2: 2
3: 37
4: 397
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251281_1145251284 -7 Left 1145251281 17:21298223-21298245 CCCCTGCAGGGCTGGTGGGCCTC 0: 1
1: 0
2: 2
3: 41
4: 326
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251272_1145251284 23 Left 1145251272 17:21298193-21298215 CCTCCAGGCCTGGGTCTGTCCTG 0: 1
1: 1
2: 6
3: 63
4: 614
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251273_1145251284 20 Left 1145251273 17:21298196-21298218 CCAGGCCTGGGTCTGTCCTGCTC 0: 1
1: 0
2: 11
3: 53
4: 507
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251271_1145251284 27 Left 1145251271 17:21298189-21298211 CCAGCCTCCAGGCCTGGGTCTGT 0: 1
1: 0
2: 1
3: 62
4: 741
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251282_1145251284 -8 Left 1145251282 17:21298224-21298246 CCCTGCAGGGCTGGTGGGCCTCC 0: 1
1: 0
2: 3
3: 38
4: 287
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164
1145251277_1145251284 4 Left 1145251277 17:21298212-21298234 CCTGCTCTGCTCCCCTGCAGGGC 0: 1
1: 0
2: 4
3: 54
4: 550
Right 1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG 0: 1
1: 0
2: 3
3: 11
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145251284 Original CRISPR GGGCCTCCTTCCCCCTTTGA AGG Intronic
900145789 1:1158181-1158203 GGGCTACCTTCCCCCTGGGACGG - Intergenic
900227359 1:1539566-1539588 GAGCCGCCTTCCACCCTTGAGGG - Intronic
900419434 1:2549348-2549370 GGGCCTCCACTTCCCTTTGATGG + Intergenic
900425800 1:2578038-2578060 GGGCCTCCACTTCCCTTTGATGG - Intergenic
900569964 1:3353349-3353371 GGGCCTCCCTCACCCAATGAGGG - Intronic
901181383 1:7344204-7344226 GGGCCTCTTTCTCCCTGTGGAGG + Intronic
902435206 1:16394115-16394137 TGGCCTCCTTCTAACTTTGAGGG + Intronic
902454287 1:16520994-16521016 GCGCCGCCTTCACCCATTGAAGG + Intergenic
903149889 1:21399228-21399250 GGCCCTCCCTACCCCTTTGCTGG + Intergenic
904567916 1:31439111-31439133 GGGCCTCCTTCCCCCTTTTGGGG + Intergenic
905884663 1:41485186-41485208 GGGCCTGCCTCCCTCTGTGAAGG + Intergenic
906248965 1:44296665-44296687 GAGCATCCTTCCACCTTTTAGGG + Intronic
906479213 1:46189292-46189314 GGGGCTCCCTCCTCCTTTGGGGG + Exonic
908216863 1:61962921-61962943 GGGCAACCTTCCTCCTTTTAAGG + Intronic
912411932 1:109485660-109485682 GGGCCTGCTTCCCCATTTAAAGG - Intronic
914516539 1:148379306-148379328 GCGCCTCCTTCACCCAGTGAGGG + Intergenic
915119840 1:153622718-153622740 TGGCCTCCTTCCAGCTGTGATGG + Intronic
920245146 1:204582288-204582310 GGGCCTCCCTCCTCTTTTCAGGG + Intergenic
920567639 1:206988157-206988179 TGGCCTCCCTACCCCATTGAAGG + Intergenic
1062821777 10:540345-540367 GGGCAGCTTTCCCCCTGTGACGG - Intronic
1062834986 10:629518-629540 GGGCTTCCTTCCCCCAGTGTGGG - Intronic
1065467934 10:26045147-26045169 TGGTCTCCTTCCCACTTTGCTGG - Intronic
1065836640 10:29664011-29664033 GGGACACGTTCCCCATTTGATGG + Intronic
1066248533 10:33609708-33609730 GCTCCTCCCTCCCCCTTTTAAGG + Intergenic
1067061097 10:43078274-43078296 AGGGCTCCTTCCCTCTTAGAGGG - Intronic
1069899894 10:71701319-71701341 GGGCCCCCTGCAGCCTTTGAGGG - Intronic
1070892372 10:79951350-79951372 GGGATTTTTTCCCCCTTTGAAGG + Intronic
1071525219 10:86354428-86354450 GGGGCTCATTCTCCCATTGAGGG - Intronic
1073428234 10:103469371-103469393 GGTCCTCCTTCCCCCGTCTAGGG + Intergenic
1073471866 10:103727518-103727540 GTCCCTCCTTCTCCCTTTCAGGG - Intronic
1075723709 10:124601233-124601255 GGCCCGCCTTGCCCCTTTCAAGG + Intronic
1077162450 11:1119944-1119966 GGGCCTCCTTTCCAGTTTGCAGG + Intergenic
1077273368 11:1692141-1692163 GGGCCTCTGTCCCTCTGTGAAGG - Intergenic
1078327606 11:10393333-10393355 GGACCTCCTTCCCCCTACCATGG + Intronic
1079148504 11:17876115-17876137 GGGCCTCATTCCTCCAGTGATGG + Intronic
1081582270 11:44360458-44360480 GGGCCCCATTCCCCTTTGGAGGG - Intergenic
1082900216 11:58240978-58241000 GGGCATCCTTTCCCCATTGTAGG + Intergenic
1084044702 11:66561890-66561912 GGGCCTCCATCCCCATCTGGAGG - Intronic
1084410834 11:69005134-69005156 GGGCCTCCTTCTCCCTGGGCTGG - Exonic
1084470933 11:69358618-69358640 GGGGCCCCCTCCCCCTTTGCAGG + Intronic
1084530851 11:69726976-69726998 AGGGTTCCTTCCCCCTCTGATGG - Intergenic
1085047130 11:73360148-73360170 GGGCCTCTGTCACCCTCTGATGG - Intronic
1085519270 11:77128603-77128625 GGGCTTCCTGCCACCCTTGAGGG + Intronic
1088607066 11:111541948-111541970 GGGCCTCCTTCCAGCTCTGACGG + Intronic
1092138868 12:6168835-6168857 GGGCCTCATGTCCCCTCTGAGGG - Intergenic
1092537582 12:9403497-9403519 GTGCCTCCTCCCCCCTGCGATGG - Intergenic
1094830572 12:34298321-34298343 GTGCATTCTTGCCCCTTTGAGGG - Intergenic
1094834072 12:34314081-34314103 GGGCATTCTTGCCACTTTGAAGG + Intergenic
1094837708 12:34329893-34329915 GGGCCTTCTTGCCACTTTGGTGG + Intergenic
1097942407 12:65325776-65325798 AGGCCTCTTTCCCACTGTGATGG + Intronic
1102002893 12:109568829-109568851 GGGTCTCCTTTCTCCTGTGAAGG + Exonic
1102128042 12:110501796-110501818 GGGCCTTTTTACCCCTTGGATGG + Intronic
1102155094 12:110719238-110719260 GGTCCCCCTTCCCTCTTTGATGG + Intergenic
1103267925 12:119646590-119646612 GGGCCTCCTTCCATCTTCAACGG + Intergenic
1103954963 12:124571005-124571027 CTGCCTCCTTCCCCCTCTGTTGG - Intergenic
1108584847 13:51862172-51862194 TGGCCGCCTGCCCCCTCTGAGGG + Exonic
1112436917 13:99397042-99397064 GGCCCACCTTCCCCCTCTTATGG - Intergenic
1113167136 13:107454425-107454447 GGGGCTCTTTCCCACTTTGTTGG - Intronic
1114227540 14:20752763-20752785 GGGCATCTTTCCCACTTGGAAGG + Intergenic
1114554903 14:23556293-23556315 GGGCTCCCTTCCCCCTCTGTGGG + Exonic
1114767338 14:25388744-25388766 GGGTCTCCTTTGTCCTTTGAAGG + Intergenic
1114972454 14:28050174-28050196 GTGCCTGCTACCCCCTTTGCAGG - Intergenic
1116514365 14:45787493-45787515 TAGCCTCCTTCCTCCTTTCAGGG - Intergenic
1119199518 14:72742362-72742384 GAGCGTCCTTCCCCCTCGGAAGG + Intronic
1119265075 14:73259577-73259599 GTCCCACCTTCCCTCTTTGACGG - Intronic
1120526770 14:85585383-85585405 AGGCTGCCTTCCCCATTTGATGG + Intronic
1120842347 14:89097082-89097104 GTGCCCTCTTCCCCCCTTGAAGG - Intergenic
1121603507 14:95223984-95224006 GGGCCTGCTACCTCCTTGGATGG - Intronic
1124861703 15:33448387-33448409 TGGCCTCCTTCACCCTTTCAGGG - Intronic
1125540376 15:40466520-40466542 GGCCCCCACTCCCCCTTTGAGGG - Exonic
1134127192 16:11624216-11624238 GGCCCTCTTTACCCCTCTGAGGG - Intronic
1135735508 16:24928596-24928618 GGGCCTCCTCCCTGTTTTGAAGG + Intronic
1136687431 16:32003463-32003485 GTGCCTCCTTCCTCCTGAGAAGG - Intergenic
1136788045 16:32947014-32947036 GTGCCTCCTTCCTCCTGAGAAGG - Intergenic
1136881740 16:33906775-33906797 GTGCCTCCTTCCTCCTGAGAAGG + Intergenic
1137910527 16:52373438-52373460 TGGCCTCCTTGCCCCTTGCAGGG - Intergenic
1140993775 16:80240730-80240752 GGGCATCCTTTCCCCATTGCTGG - Intergenic
1141081979 16:81060796-81060818 GGGCCTCCTTCCCTCCATGCTGG - Intronic
1203090270 16_KI270728v1_random:1208671-1208693 GTGCCTCCTTCCTCCTGAGAAGG - Intergenic
1143389255 17:6550525-6550547 CGGCATCCTTTCCCCTTTCAAGG - Intronic
1143609003 17:8006951-8006973 GGGCCCCCATCCCCCTTTCCTGG + Intronic
1145251284 17:21298239-21298261 GGGCCTCCTTCCCCCTTTGAAGG + Intronic
1145787348 17:27602910-27602932 GGGCTTTCTTCTGCCTTTGAAGG - Intronic
1145898985 17:28477612-28477634 GCTCCTTCTTCCCCCTTTGGAGG - Intronic
1146716108 17:35088710-35088732 CGGCCTGCTTACCCCTTTAAAGG - Intronic
1147148411 17:38499132-38499154 GTGCCTCCTTCCTCCTGAGAAGG - Intronic
1147422688 17:40330521-40330543 GGCCCTCCTTCCCCCAGTGAGGG - Intronic
1148848659 17:50543489-50543511 CAGCCTCCATCCCCCTTTCAGGG + Exonic
1150496996 17:65615509-65615531 GCCCCTTCATCCCCCTTTGAGGG - Intronic
1152352901 17:79793224-79793246 GCTCCTCCCTCCCCCTTTGGCGG + Exonic
1152743154 17:82027308-82027330 GGCTCTCCTTCCCCCTGAGAAGG + Intronic
1153675723 18:7454518-7454540 GGGCAGCCTTCCCTCTGTGATGG + Intergenic
1154072183 18:11162601-11162623 GGGTCTCCTTCGCCCATTGTAGG + Intergenic
1157187453 18:45552686-45552708 TGGTCTCCTTCCCCCTTTCCAGG - Intronic
1160147854 18:76379133-76379155 GCGCCCCCTTCGCCCTTTGCAGG + Exonic
1161393769 19:4034240-4034262 GGGCCTGCTCCCGCCTGTGAGGG - Intronic
1162396799 19:10421747-10421769 GGGACTCCTTCCCTCTGTGCTGG - Intronic
1167379425 19:49129898-49129920 GGGCCGCCTATCCCCTTAGAGGG + Intronic
926559623 2:14401980-14402002 GGGCCTCTTTCCCCCTGAGGTGG - Intergenic
929608354 2:43251004-43251026 AGGCCTCCTTCCCTGTTTGCTGG + Intronic
930501009 2:52217403-52217425 GAACCTCTTTCCCACTTTGATGG - Intergenic
931172786 2:59822433-59822455 GAGTCTCCTTCTACCTTTGAGGG - Intergenic
933369136 2:81393194-81393216 ATGCCTCCTTCTCCCTCTGAAGG + Intergenic
942089097 2:172471311-172471333 GAGGTTTCTTCCCCCTTTGAGGG - Intronic
944211465 2:197210838-197210860 TGTCCTCCTGCCACCTTTGATGG + Intronic
946412390 2:219521829-219521851 GGGCCTCCTGCCCCCAGTGCTGG - Intronic
947432755 2:230045131-230045153 CGGGCTCCTTACCCATTTGAAGG - Intronic
1168979704 20:1994068-1994090 GTGCCTCTTCCCCCCTTTTATGG + Exonic
1169349199 20:4854622-4854644 GGGCTTCCTTCCCTGTGTGAAGG + Exonic
1171377473 20:24703190-24703212 GGGGCTCCATCCCCCAGTGATGG - Intergenic
1176016699 20:62937695-62937717 GGGACTCCCTCCCCGTCTGAGGG + Intronic
1182269169 22:29142705-29142727 GGGCCTCCTTCAGCCTGGGAGGG + Intronic
1182606311 22:31507243-31507265 GGGACTCCTTTCCCCATTGCTGG - Intronic
1185026286 22:48415076-48415098 GGGCCTCTTTTCCTCTTTGTGGG + Intergenic
1185026290 22:48415096-48415118 GGGCCTCTTTTCCTCTTTGTGGG + Intergenic
1185026294 22:48415116-48415138 GGGCCTCTTTTCCTCTTTGTGGG + Intergenic
1185026298 22:48415136-48415158 GGGCCTCTTTTCCTCTTTGTGGG + Intergenic
1185026302 22:48415156-48415178 GGGCCTCTTTTCCTCTTTGTGGG + Intergenic
1185318801 22:50190832-50190854 CCGCCTCCTTCCCCTTTTGTAGG - Intronic
950055626 3:10022036-10022058 GGGCATCCTTCCCCATTGGGTGG - Intergenic
950141672 3:10620260-10620282 GGGCATCCTCCCCTCTTTGCTGG + Intronic
950853742 3:16086742-16086764 GTGCCTCCTTCTCCCTCTCAAGG + Intergenic
952301716 3:32109371-32109393 GAGCCTCCTGCCCCCTCTGCTGG + Intronic
952714264 3:36463347-36463369 TGTCCTCCTTGCACCTTTGATGG + Intronic
954445714 3:50545833-50545855 CCTCCTCCTGCCCCCTTTGAGGG + Intergenic
955092961 3:55770493-55770515 GTGCCCCCTTCCCCCTTTGATGG + Intronic
957136302 3:76293896-76293918 GGGCCTCCTGCCACCATTCACGG + Intronic
960775905 3:121252986-121253008 GGGCCTCAGTCCCTCTTTTAAGG + Intronic
969447550 4:7253744-7253766 GGGCCTCCTGCCCACCTGGAGGG - Intronic
970197790 4:13570034-13570056 GGGCTTCCTCCACCCTTTGCTGG + Exonic
970328848 4:14957775-14957797 GGGCCTCCTTCCTCCTTCTGTGG - Intergenic
972696170 4:41449072-41449094 GGGCCTCCCTCCCGTTTTGATGG + Intronic
982849773 4:160297653-160297675 GGGCTTCCTTGGCCCTTTTATGG - Intergenic
985667342 5:1187935-1187957 GTGCCTCCTTGTCCCCTTGAAGG + Intergenic
986039480 5:3976750-3976772 GGGCCTTCTTCCTTCTTTCAGGG - Intergenic
995885862 5:116893583-116893605 AGGCCTCCTTCCCCCTACCAAGG + Intergenic
1004051899 6:12090626-12090648 TGGCCACCTTGTCCCTTTGAAGG + Intronic
1004631676 6:17427309-17427331 GGCTCTCCTTCCCACTGTGATGG + Intronic
1005781912 6:29201484-29201506 GGGCCTCCTGCCACTGTTGACGG - Intergenic
1015264867 6:131280702-131280724 GGGGCTCCTTCCCCAGTTAAGGG - Intronic
1019310260 7:357046-357068 GGGCCTCTGCCCCCCTTGGATGG + Intergenic
1019599689 7:1875000-1875022 GGGCCTCCTTCCCCTCTGCAGGG + Intronic
1019684158 7:2371307-2371329 TGGCCTCCTTCCTCTGTTGATGG + Intronic
1019714067 7:2530328-2530350 GGGCCTGCTTCCCCTTTTGAGGG - Intergenic
1019807996 7:3142762-3142784 GGTCCACCTTCCCCCATTGGTGG - Intronic
1021286449 7:18786979-18787001 GTGCTTCCTTCCCTCTTTTAAGG + Intronic
1021792207 7:24217114-24217136 AGGCCTCCTTATCACTTTGAAGG + Intergenic
1023479421 7:40616785-40616807 AGGCCTCCATTCCCCTTGGAGGG - Intronic
1027772495 7:82425183-82425205 GGGGCTCAATACCCCTTTGAAGG - Intronic
1034069751 7:148172784-148172806 AGGCCTGATTCCCCTTTTGAAGG - Intronic
1034341877 7:150362527-150362549 AGGCCTCCTTCCACCTGAGATGG + Intergenic
1037789084 8:21920308-21920330 CGGCCTCCTTCCCCCTCCCACGG + Intronic
1040455337 8:47592459-47592481 AGGATTCCTTCCCCCTTTGAGGG - Intronic
1042168108 8:65966100-65966122 AGGCCTGCTTTCCCCTTTGCAGG - Intergenic
1043288766 8:78569299-78569321 GAGCCTCCATTCCCATTTGAAGG + Intronic
1047305925 8:123652927-123652949 GGGCTTCCTTCCCTCTTTGTAGG - Exonic
1049008863 8:139874310-139874332 TGGCCTCATTCACTCTTTGATGG + Intronic
1049408413 8:142461786-142461808 GGGCCTCCTTTGCACTTGGAGGG + Intronic
1049767651 8:144362427-144362449 GGGGCTCCTTCCTCCTCTGATGG - Intergenic
1052348117 9:27430315-27430337 GGGCCTGCTTTCCTCTTTGTGGG - Intronic
1052469076 9:28870057-28870079 GTCCCTCCTTCACTCTTTGAAGG + Intergenic
1053001296 9:34578451-34578473 GGGCCTCCTTTCCCCTCCCAAGG + Intronic
1056630823 9:88291473-88291495 GTGCCTCCATCTCCCATTGATGG + Intergenic
1056800108 9:89685216-89685238 GCGCCTGCTTCTCCCTTAGAAGG + Intergenic
1057231349 9:93323513-93323535 GGGCCTTCTGCCCCCTCTCAAGG - Intronic
1057425814 9:94948667-94948689 AGGGCTCCTTCACCCTTTAAAGG - Intronic
1057501837 9:95602464-95602486 GGGCCCCCTTCCCCCTACCAGGG + Intergenic
1060514039 9:124254780-124254802 GGGTCCCCCTCCCCCTTGGATGG - Intergenic
1061751112 9:132777632-132777654 GGGGCTACTACTCCCTTTGATGG + Intronic
1062048990 9:134437613-134437635 AGGCCACCTGCCCCCTCTGAGGG - Intronic
1062395754 9:136351965-136351987 GGGCCCCCTTCCCCCTCTGCTGG + Intronic
1062626582 9:137445734-137445756 GGGCCATCTTGCCCCTTTCAGGG + Intergenic
1062710441 9:137972410-137972432 GGGCCTCAGTCTCCCCTTGAGGG + Intronic
1185541040 X:903111-903133 TGGCCTCCTTGCCTCTTTGCAGG - Intergenic
1185545685 X:941980-942002 GGGCTTCCTTCCTCCTTCGAGGG + Intergenic
1196735459 X:118977446-118977468 GAGCCTCCTTTCCTCTTAGAAGG - Intronic
1197319038 X:125005785-125005807 GGGCCTCCTTCCCCCAGCCAAGG + Intergenic
1197393619 X:125898547-125898569 GGCTCTCCATCTCCCTTTGAGGG - Intergenic
1197433958 X:126401532-126401554 TGCTCTCCTTCCCCCTATGAAGG + Intergenic