ID: 1145252316

View in Genome Browser
Species Human (GRCh38)
Location 17:21303308-21303330
Sequence CGGAGCCACAGTTGCTCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145252316_1145252323 9 Left 1145252316 17:21303308-21303330 CCCTATGAGCAACTGTGGCTCCG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1145252323 17:21303340-21303362 AGGTTGTGACGTGCCCGATGGGG 0: 1
1: 0
2: 1
3: 5
4: 34
1145252316_1145252322 8 Left 1145252316 17:21303308-21303330 CCCTATGAGCAACTGTGGCTCCG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1145252322 17:21303339-21303361 TAGGTTGTGACGTGCCCGATGGG 0: 1
1: 0
2: 0
3: 0
4: 12
1145252316_1145252321 7 Left 1145252316 17:21303308-21303330 CCCTATGAGCAACTGTGGCTCCG 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1145252321 17:21303338-21303360 ATAGGTTGTGACGTGCCCGATGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145252316 Original CRISPR CGGAGCCACAGTTGCTCATA GGG (reversed) Intronic
903380920 1:22896339-22896361 GGGAGCCACAGTAGGTGATAGGG - Intronic
912684223 1:111749298-111749320 CAGAGCCACAGAAGCTCAGATGG - Intronic
914465034 1:147920014-147920036 AGAGGCCACTGTTGCTCATAGGG + Intergenic
1067804133 10:49381645-49381667 CGGTGCCCCAGTTGCTCACTGGG + Intronic
1072459122 10:95603513-95603535 TGCAGCTACAGTTGCTCATGTGG + Intergenic
1074912563 10:117924757-117924779 CTGAGCCCCAGTTGCTCATGTGG + Intergenic
1083676333 11:64327483-64327505 AGCAGCCACAGTGGATCATAAGG - Intergenic
1087159236 11:94933011-94933033 TGGAGCCACAGATGCTTAAAAGG - Intergenic
1089180858 11:116581927-116581949 CTGAGCCTCAGTTGCTCATTAGG - Intergenic
1090108963 11:123884258-123884280 AGGAGCCAAAGTTCCTCAGAAGG - Intronic
1095849714 12:46789079-46789101 CTGAGCCACAGTTCCCTATAGGG - Intronic
1097255484 12:57670513-57670535 CGGAGTCCCAGTTGCTCAGGAGG + Intergenic
1099501941 12:83424124-83424146 CTGTGCCACAGTTTCTCAAATGG - Intergenic
1102207165 12:111098606-111098628 CGGAGCCCCAGTTGACAATATGG + Intronic
1102669146 12:114602303-114602325 TGGAGCCACAGCTGTTCACAGGG + Intergenic
1104068984 12:125328485-125328507 CAGAGCCACACTTGCTCTGAAGG + Intronic
1104074710 12:125378867-125378889 CTGAGCCTCATTTGCTCATATGG + Intronic
1104561793 12:129852420-129852442 TGTAGTCACAGCTGCTCATAAGG + Intronic
1104653797 12:130557888-130557910 CGAAGCCACAGCTGCTCACTGGG - Intronic
1105267252 13:18831855-18831877 CACAGCAACAGTTGCTCAGAGGG - Intergenic
1110876152 13:80512759-80512781 CAGAGCCACCGTTTCTCATGTGG + Intergenic
1113846253 13:113393494-113393516 CGGACACACAGTTGCACATATGG + Intergenic
1119826355 14:77660334-77660356 CGGAGCTACAGTTGCATATTAGG + Intergenic
1126182521 15:45799608-45799630 CAGAGCCACACTTCCTCAGAAGG + Intergenic
1127899325 15:63329628-63329650 GGGAGCCACAGTTGTACAGATGG + Intronic
1130085288 15:80773221-80773243 CGGAGAAACAATTGCTCATGTGG - Intergenic
1141912800 16:87071401-87071423 CTGAGCCACAGATGTTTATATGG + Intergenic
1143256342 17:5560709-5560731 TGGAGCCTCAGTTGCTCACAAGG + Intronic
1145252316 17:21303308-21303330 CGGAGCCACAGTTGCTCATAGGG - Intronic
1145388163 17:22433786-22433808 CTGAGCCTCAGTTTTTCATAGGG + Intergenic
1151410666 17:73925566-73925588 GGGAGCCACAGCTTTTCATATGG - Intergenic
1154421158 18:14229574-14229596 CACAGCAACAGTTGCTCAGAGGG + Intergenic
1162004883 19:7771384-7771406 CTGAGCCCCAGTTGCCCACATGG + Intergenic
1162792932 19:13072336-13072358 CGGTGCCACAGCTGCTCAGAGGG - Intronic
1202641186 1_KI270706v1_random:88121-88143 CACAGCAACAGTTGCTCAGAGGG - Intergenic
925574774 2:5349496-5349518 CGTTGCCATAATTGCTCATAAGG + Intergenic
936487600 2:112939671-112939693 CAGAGCCACAGCTGCTCACTGGG - Intergenic
938149670 2:128871310-128871332 AGGAGCCACAGCTGCACATTTGG - Intergenic
941703001 2:168625722-168625744 AGGAGCCACAGTGGCTCAGCAGG + Intronic
942938574 2:181589192-181589214 GGGAGCCACAGTTCTTAATATGG - Intronic
942938780 2:181591658-181591680 GGGAGCCACAGTTCTTAATATGG + Intronic
947708179 2:232293225-232293247 CTGAGCCACAGCTGGTCATCTGG + Intronic
948348594 2:237320000-237320022 CTGAGCCCCAGTTGCTCTCAAGG + Intergenic
1168960881 20:1868857-1868879 AGGTGCCTCAGTTGCTCATTTGG - Intergenic
1169181828 20:3575922-3575944 AGGAACCACAGCTGCTCAGAAGG + Exonic
1169550302 20:6695431-6695453 TTAAGCCTCAGTTGCTCATAAGG - Intergenic
1172596944 20:36156119-36156141 CTGGGCCACGGTGGCTCATAGGG - Intronic
1175670803 20:60901214-60901236 CTGAGCCCCAGTTGTTCACAAGG + Intergenic
1176852317 21:13930385-13930407 CACAGCAACAGTTGCTCAGAGGG - Intergenic
1178340467 21:31781888-31781910 AGGCCCCACAGTTGCTCATCTGG + Intergenic
1182765316 22:32753921-32753943 CAGAGCCTCAATTTCTCATATGG - Intronic
950832078 3:15885003-15885025 CGCAGCCACATTTGCCCATAAGG - Intergenic
953960774 3:47264129-47264151 CTGAGCCACAGTTGCTGAGGGGG - Intronic
964877437 3:161384208-161384230 CAGAGCCAGAGTTGTTCTTATGG + Intergenic
1202737385 3_GL000221v1_random:19241-19263 CACAGCAACAGTTGCTCAGAGGG + Intergenic
972649207 4:41000137-41000159 CGTAGTCACAGTTACTCAGAAGG + Intronic
973384697 4:49498647-49498669 CACAGCAACAGTTGCTCAGAGGG - Intergenic
974163040 4:58165186-58165208 CTGAGCCACTGTGTCTCATAAGG - Intergenic
982351247 4:154417441-154417463 TGGGGCCACAGTTGCTCTGAGGG - Intronic
1202768548 4_GL000008v2_random:173981-174003 CACAGCAACAGTTGCTCAGAGGG - Intergenic
995226325 5:109705249-109705271 TGGAGCCACAGTAGGGCATATGG - Intronic
995833450 5:116377974-116377996 CAGAGCCTCAGTTGTTCAGAGGG - Intronic
996969248 5:129343794-129343816 CTGAGCCCCAGTTGCCCAAATGG - Intergenic
997655694 5:135552752-135552774 CAGTGCCATAGCTGCTCATATGG - Intergenic
998171382 5:139873803-139873825 CGGGGCCACAGTTGCACACTTGG + Intronic
1001040498 5:168331190-168331212 TAGAGCTACAGGTGCTCATAGGG + Intronic
1008823749 6:55665988-55666010 GGGAACCATAGTTTCTCATATGG - Intergenic
1008961069 6:57266471-57266493 TGCAACCACAGTTGCTTATAGGG + Intergenic
1009925169 6:70112186-70112208 TGGAGGCACAGTTGTTCCTAAGG + Intronic
1016603564 6:145891225-145891247 AGGAGCTACAGTTGCTAAAAGGG - Intronic
1020361864 7:7335422-7335444 CAGAGGAACAGTTGCTCATCGGG - Intergenic
1037026398 8:14043629-14043651 CTGAGCCTCAGATGTTCATAGGG - Intergenic
1037037619 8:14187113-14187135 CTGACCCACAGTTCCTCAGAGGG - Intronic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1047254885 8:123207337-123207359 CGGAGCCACTGCTGCTGCTAAGG - Exonic
1051175570 9:14356311-14356333 CCGAGCCACACTAGCTCATGTGG - Intronic
1052050502 9:23842386-23842408 CAGAGCCACTGTTGCCCAAATGG + Intergenic
1053660161 9:40268915-40268937 CACAGCAACAGTTGCTCAGAGGG + Intronic
1053910537 9:42898270-42898292 CACAGCAACAGTTGCTCAGAGGG + Intergenic
1054372294 9:64415219-64415241 CACAGCAACAGTTGCTCAGAGGG + Intergenic
1054524437 9:66107302-66107324 CACAGCAACAGTTGCTCAGAGGG - Intronic
1054679912 9:67904916-67904938 CACAGCAACAGTTGCTCAGAGGG + Intergenic
1203706109 Un_KI270742v1:49691-49713 CACAGCAACAGTTGCTCAGAGGG + Intergenic
1189207286 X:39252812-39252834 TTGAGCCCCAGTTGCTCAAAGGG - Intergenic
1200277885 X:154751247-154751269 CGGAGCTGCAGTTGCTCGAAGGG - Intronic