ID: 1145255969

View in Genome Browser
Species Human (GRCh38)
Location 17:21322584-21322606
Sequence CTGCTGGCCCTGGGCACCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145255964_1145255969 -7 Left 1145255964 17:21322568-21322590 CCTGACATGAGACAACCTGCTGG No data
Right 1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG No data
1145255961_1145255969 22 Left 1145255961 17:21322539-21322561 CCTGCTCTCAGGCTCGGCTTCTG No data
Right 1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG No data
1145255959_1145255969 29 Left 1145255959 17:21322532-21322554 CCTGAATCCTGCTCTCAGGCTCG No data
Right 1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145255969 Original CRISPR CTGCTGGCCCTGGGCACCAC AGG Intergenic
No off target data available for this crispr