ID: 1145256768

View in Genome Browser
Species Human (GRCh38)
Location 17:21329411-21329433
Sequence GAGCCGTGAAGTTAGAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145256768_1145256770 22 Left 1145256768 17:21329411-21329433 CCACTTTTCTAACTTCACGGCTC No data
Right 1145256770 17:21329456-21329478 TTTGTGAAGTGTTAAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145256768 Original CRISPR GAGCCGTGAAGTTAGAAAAG TGG (reversed) Intergenic
No off target data available for this crispr