ID: 1145256770

View in Genome Browser
Species Human (GRCh38)
Location 17:21329456-21329478
Sequence TTTGTGAAGTGTTAAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145256768_1145256770 22 Left 1145256768 17:21329411-21329433 CCACTTTTCTAACTTCACGGCTC No data
Right 1145256770 17:21329456-21329478 TTTGTGAAGTGTTAAAAAATAGG No data
1145256769_1145256770 -9 Left 1145256769 17:21329442-21329464 CCTCTTCTGTTGCTTTTGTGAAG No data
Right 1145256770 17:21329456-21329478 TTTGTGAAGTGTTAAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145256770 Original CRISPR TTTGTGAAGTGTTAAAAAAT AGG Intergenic
No off target data available for this crispr