ID: 1145258373

View in Genome Browser
Species Human (GRCh38)
Location 17:21340127-21340149
Sequence CAATCTCCTCCCTGTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145258365_1145258373 20 Left 1145258365 17:21340084-21340106 CCCTGATGGAGATGAGGCCTTGA No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data
1145258366_1145258373 19 Left 1145258366 17:21340085-21340107 CCTGATGGAGATGAGGCCTTGAG No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data
1145258369_1145258373 -10 Left 1145258369 17:21340114-21340136 CCCCTTGAAAGCTCAATCTCCTC No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data
1145258364_1145258373 21 Left 1145258364 17:21340083-21340105 CCCCTGATGGAGATGAGGCCTTG No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data
1145258367_1145258373 3 Left 1145258367 17:21340101-21340123 CCTTGAGTTCTGCCCCCTTGAAA No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data
1145258368_1145258373 -9 Left 1145258368 17:21340113-21340135 CCCCCTTGAAAGCTCAATCTCCT No data
Right 1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145258373 Original CRISPR CAATCTCCTCCCTGTGAAAT GGG Intergenic
No off target data available for this crispr