ID: 1145259990

View in Genome Browser
Species Human (GRCh38)
Location 17:21348978-21349000
Sequence AGGGTCAGAGCAGGGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259990_1145260004 25 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145260004 17:21349026-21349048 CCTCAGGCTTCTGCGCTTGGTGG No data
1145259990_1145259997 9 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259990_1145260005 28 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259990_1145260001 22 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145259990 Original CRISPR AGGGTCAGAGCAGGGGCCCA TGG (reversed) Intergenic
No off target data available for this crispr