ID: 1145259996

View in Genome Browser
Species Human (GRCh38)
Location 17:21348998-21349020
Sequence GGATACTGGGAAATGACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259996_1145260011 19 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260011 17:21349040-21349062 GCTTGGTGGTGGTGGGGGAAGGG No data
1145259996_1145260012 20 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260012 17:21349041-21349063 CTTGGTGGTGGTGGGGGAAGGGG No data
1145259996_1145260009 14 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260009 17:21349035-21349057 TCTGCGCTTGGTGGTGGTGGGGG No data
1145259996_1145260004 5 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260004 17:21349026-21349048 CCTCAGGCTTCTGCGCTTGGTGG No data
1145259996_1145260013 21 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260013 17:21349042-21349064 TTGGTGGTGGTGGGGGAAGGGGG No data
1145259996_1145260007 12 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260007 17:21349033-21349055 CTTCTGCGCTTGGTGGTGGTGGG No data
1145259996_1145260006 11 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260006 17:21349032-21349054 GCTTCTGCGCTTGGTGGTGGTGG No data
1145259996_1145260010 18 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260010 17:21349039-21349061 CGCTTGGTGGTGGTGGGGGAAGG No data
1145259996_1145260008 13 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260008 17:21349034-21349056 TTCTGCGCTTGGTGGTGGTGGGG No data
1145259996_1145260005 8 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259996_1145260001 2 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145259996 Original CRISPR GGATACTGGGAAATGACCTG AGG (reversed) Intergenic
No off target data available for this crispr