ID: 1145259997

View in Genome Browser
Species Human (GRCh38)
Location 17:21349010-21349032
Sequence TCCCAGTATCCTTTGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259982_1145259997 22 Left 1145259982 17:21348965-21348987 CCCCATCCCACCCCCATGGGCCC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259993_1145259997 1 Left 1145259993 17:21348986-21349008 CCCTGCTCTGACCCTCAGGTCAT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259987_1145259997 12 Left 1145259987 17:21348975-21348997 CCCCCATGGGCCCCTGCTCTGAC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259983_1145259997 21 Left 1145259983 17:21348966-21348988 CCCATCCCACCCCCATGGGCCCC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259990_1145259997 9 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259989_1145259997 10 Left 1145259989 17:21348977-21348999 CCCATGGGCCCCTGCTCTGACCC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259994_1145259997 0 Left 1145259994 17:21348987-21349009 CCTGCTCTGACCCTCAGGTCATT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259986_1145259997 15 Left 1145259986 17:21348972-21348994 CCACCCCCATGGGCCCCTGCTCT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259988_1145259997 11 Left 1145259988 17:21348976-21348998 CCCCATGGGCCCCTGCTCTGACC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259984_1145259997 20 Left 1145259984 17:21348967-21348989 CCATCCCACCCCCATGGGCCCCT No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259995_1145259997 -10 Left 1145259995 17:21348997-21349019 CCCTCAGGTCATTTCCCAGTATC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259992_1145259997 2 Left 1145259992 17:21348985-21349007 CCCCTGCTCTGACCCTCAGGTCA No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data
1145259985_1145259997 16 Left 1145259985 17:21348971-21348993 CCCACCCCCATGGGCCCCTGCTC No data
Right 1145259997 17:21349010-21349032 TCCCAGTATCCTTTGCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145259997 Original CRISPR TCCCAGTATCCTTTGCCCTC AGG Intergenic
No off target data available for this crispr