ID: 1145259998

View in Genome Browser
Species Human (GRCh38)
Location 17:21349011-21349033
Sequence GCCTGAGGGCAAAGGATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259998_1145260011 6 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260011 17:21349040-21349062 GCTTGGTGGTGGTGGGGGAAGGG No data
1145259998_1145260009 1 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260009 17:21349035-21349057 TCTGCGCTTGGTGGTGGTGGGGG No data
1145259998_1145260007 -1 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260007 17:21349033-21349055 CTTCTGCGCTTGGTGGTGGTGGG No data
1145259998_1145260004 -8 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260004 17:21349026-21349048 CCTCAGGCTTCTGCGCTTGGTGG No data
1145259998_1145260013 8 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260013 17:21349042-21349064 TTGGTGGTGGTGGGGGAAGGGGG No data
1145259998_1145260006 -2 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260006 17:21349032-21349054 GCTTCTGCGCTTGGTGGTGGTGG No data
1145259998_1145260005 -5 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259998_1145260012 7 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260012 17:21349041-21349063 CTTGGTGGTGGTGGGGGAAGGGG No data
1145259998_1145260008 0 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260008 17:21349034-21349056 TTCTGCGCTTGGTGGTGGTGGGG No data
1145259998_1145260010 5 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260010 17:21349039-21349061 CGCTTGGTGGTGGTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145259998 Original CRISPR GCCTGAGGGCAAAGGATACT GGG (reversed) Intergenic
No off target data available for this crispr