ID: 1145260001

View in Genome Browser
Species Human (GRCh38)
Location 17:21349023-21349045
Sequence TGCCCTCAGGCTTCTGCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259986_1145260001 28 Left 1145259986 17:21348972-21348994 CCACCCCCATGGGCCCCTGCTCT No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259987_1145260001 25 Left 1145259987 17:21348975-21348997 CCCCCATGGGCCCCTGCTCTGAC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259993_1145260001 14 Left 1145259993 17:21348986-21349008 CCCTGCTCTGACCCTCAGGTCAT No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259990_1145260001 22 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259989_1145260001 23 Left 1145259989 17:21348977-21348999 CCCATGGGCCCCTGCTCTGACCC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259985_1145260001 29 Left 1145259985 17:21348971-21348993 CCCACCCCCATGGGCCCCTGCTC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259994_1145260001 13 Left 1145259994 17:21348987-21349009 CCTGCTCTGACCCTCAGGTCATT No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259995_1145260001 3 Left 1145259995 17:21348997-21349019 CCCTCAGGTCATTTCCCAGTATC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259988_1145260001 24 Left 1145259988 17:21348976-21348998 CCCCATGGGCCCCTGCTCTGACC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259996_1145260001 2 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data
1145259992_1145260001 15 Left 1145259992 17:21348985-21349007 CCCCTGCTCTGACCCTCAGGTCA No data
Right 1145260001 17:21349023-21349045 TGCCCTCAGGCTTCTGCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145260001 Original CRISPR TGCCCTCAGGCTTCTGCGCT TGG Intergenic
No off target data available for this crispr