ID: 1145260005

View in Genome Browser
Species Human (GRCh38)
Location 17:21349029-21349051
Sequence CAGGCTTCTGCGCTTGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145259994_1145260005 19 Left 1145259994 17:21348987-21349009 CCTGCTCTGACCCTCAGGTCATT No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259992_1145260005 21 Left 1145259992 17:21348985-21349007 CCCCTGCTCTGACCCTCAGGTCA No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259993_1145260005 20 Left 1145259993 17:21348986-21349008 CCCTGCTCTGACCCTCAGGTCAT No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259988_1145260005 30 Left 1145259988 17:21348976-21348998 CCCCATGGGCCCCTGCTCTGACC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259990_1145260005 28 Left 1145259990 17:21348978-21349000 CCATGGGCCCCTGCTCTGACCCT No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259998_1145260005 -5 Left 1145259998 17:21349011-21349033 CCCAGTATCCTTTGCCCTCAGGC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259995_1145260005 9 Left 1145259995 17:21348997-21349019 CCCTCAGGTCATTTCCCAGTATC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259989_1145260005 29 Left 1145259989 17:21348977-21348999 CCCATGGGCCCCTGCTCTGACCC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259999_1145260005 -6 Left 1145259999 17:21349012-21349034 CCAGTATCCTTTGCCCTCAGGCT No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data
1145259996_1145260005 8 Left 1145259996 17:21348998-21349020 CCTCAGGTCATTTCCCAGTATCC No data
Right 1145260005 17:21349029-21349051 CAGGCTTCTGCGCTTGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145260005 Original CRISPR CAGGCTTCTGCGCTTGGTGG TGG Intergenic
No off target data available for this crispr