ID: 1145260492

View in Genome Browser
Species Human (GRCh38)
Location 17:21351882-21351904
Sequence AGAGCTTCTTCACTGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145260479_1145260492 24 Left 1145260479 17:21351835-21351857 CCCCTTGCCCCCCAGGTTGGTGT No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260488_1145260492 13 Left 1145260488 17:21351846-21351868 CCAGGTTGGTGTTGAGGACAGGC No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260485_1145260492 15 Left 1145260485 17:21351844-21351866 CCCCAGGTTGGTGTTGAGGACAG No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260481_1145260492 22 Left 1145260481 17:21351837-21351859 CCTTGCCCCCCAGGTTGGTGTTG No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260486_1145260492 14 Left 1145260486 17:21351845-21351867 CCCAGGTTGGTGTTGAGGACAGG No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260480_1145260492 23 Left 1145260480 17:21351836-21351858 CCCTTGCCCCCCAGGTTGGTGTT No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260483_1145260492 17 Left 1145260483 17:21351842-21351864 CCCCCCAGGTTGGTGTTGAGGAC No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data
1145260484_1145260492 16 Left 1145260484 17:21351843-21351865 CCCCCAGGTTGGTGTTGAGGACA No data
Right 1145260492 17:21351882-21351904 AGAGCTTCTTCACTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145260492 Original CRISPR AGAGCTTCTTCACTGGGCCA TGG Intergenic
No off target data available for this crispr