ID: 1145266202

View in Genome Browser
Species Human (GRCh38)
Location 17:21380719-21380741
Sequence ATGTCCAAGGGAAGGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145266202_1145266216 24 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266216 17:21380766-21380788 GCAGCGAGTTGCTGTAGCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 124
1145266202_1145266212 1 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266212 17:21380743-21380765 TAGGGAAGCAGGCCCAGGGCAGG 0: 1
1: 2
2: 1
3: 64
4: 471
1145266202_1145266217 25 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266217 17:21380767-21380789 CAGCGAGTTGCTGTAGCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 92
1145266202_1145266213 2 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266213 17:21380744-21380766 AGGGAAGCAGGCCCAGGGCAGGG 0: 1
1: 1
2: 14
3: 93
4: 799
1145266202_1145266211 -3 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266211 17:21380739-21380761 CATGTAGGGAAGCAGGCCCAGGG 0: 1
1: 1
2: 0
3: 21
4: 224
1145266202_1145266210 -4 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266210 17:21380738-21380760 ACATGTAGGGAAGCAGGCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 220
1145266202_1145266209 -10 Left 1145266202 17:21380719-21380741 CCATCCAACCTTCCCTTGGACAT 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1145266209 17:21380732-21380754 CCTTGGACATGTAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145266202 Original CRISPR ATGTCCAAGGGAAGGTTGGA TGG (reversed) Intronic
900320789 1:2082691-2082713 ATCTCCAGGGGAGGGTTGGGCGG - Intronic
902663929 1:17924375-17924397 ATGTATGATGGAAGGTTGGATGG - Intergenic
904056839 1:27676443-27676465 AAGACCAAGGCAAGGTTAGAGGG - Intergenic
907491170 1:54809821-54809843 AGGTACGAGGGAAGGTGGGAAGG - Intronic
907825856 1:58016227-58016249 ATGTCCAAGGGCAGAATGGTTGG - Intronic
911039142 1:93578574-93578596 ATGTCCAAGATGAGTTTGGAAGG - Intronic
912274983 1:108246777-108246799 ATGTCCTAGGGCAGGAAGGAAGG + Intergenic
912286284 1:108373005-108373027 ATGTCCTAGGGCAGGAAGGAAGG - Intergenic
912293239 1:108447574-108447596 ATGTCCTAGGGCAGGAAGGAAGG - Intronic
915089977 1:153417446-153417468 ATTCCCAAGGGAATGTAGGAAGG + Intronic
915340028 1:155172315-155172337 AGCTCCCAGGGAAGGTTTGAGGG - Intronic
917709623 1:177671125-177671147 AAGACCAAGGGAAGGGTAGAGGG - Intergenic
920595460 1:207264811-207264833 ATGTCCAAGGGCAGGAGGAATGG - Intergenic
922984559 1:229856324-229856346 ATGTCCAAGAGAAATTTTGAAGG - Intergenic
923845566 1:237727784-237727806 ATGTCTAAGAGAAGGTTGACGGG - Intronic
924307978 1:242711351-242711373 ATGTCTAAAAGAAGGTTGTAGGG - Intergenic
1062877569 10:954945-954967 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1062877606 10:955075-955097 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1063785734 10:9380717-9380739 ATGTCCAAGGGCAGGAGGGGAGG - Intergenic
1064167639 10:13000899-13000921 AAGTCAAAGGGACTGTTGGAGGG + Intronic
1067733402 10:48830290-48830312 ACATGTAAGGGAAGGTTGGAAGG + Intronic
1068108743 10:52653267-52653289 ATGTCCAAGAGCAGGTTAGAAGG + Intergenic
1071263120 10:83939131-83939153 TTGTCCAAGGGATGGTGAGAAGG - Intergenic
1072210866 10:93246082-93246104 ATTTCGAAGGGAATGTTTGAGGG - Intergenic
1073348273 10:102800856-102800878 CTTTCCAAAGGAAGGTGGGAAGG - Intronic
1074425375 10:113346706-113346728 CTCTCCAAGGGAAGGGTGGAAGG - Intergenic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076186232 10:128451735-128451757 ATGTCAGAGGGAACGTTGGCAGG + Intergenic
1076298357 10:129404792-129404814 ATATCAAAGGGAAGCTTGGCTGG + Intergenic
1076451507 10:130560049-130560071 ATGTCCTAGGCAAGGTGGTAGGG - Intergenic
1076745822 10:132512996-132513018 ATGTCCAAGAGAAGAGTGAAAGG - Intergenic
1084744104 11:71156648-71156670 GTGTCCAGAGGAGGGTTGGAGGG - Intronic
1085437565 11:76522102-76522124 ATTTACAACTGAAGGTTGGAAGG + Intronic
1086335793 11:85799596-85799618 ATGTTCAAGGTAAGGCTGGCAGG - Intronic
1086500588 11:87449136-87449158 ATGTCAAAGGCTAGATTGGAGGG + Intergenic
1087760193 11:102097421-102097443 ATGTCCCAGGGAAGGTCAAAGGG + Intergenic
1088606730 11:111540517-111540539 ATCTCCCAGGGAAGCTCGGAGGG + Intronic
1089738089 11:120563745-120563767 ATGACCTGGGGAAGGGTGGAGGG - Intronic
1089834042 11:121354251-121354273 ATGTCCAATGGCAGGAAGGATGG - Intergenic
1089834559 11:121358556-121358578 ATTTCCATGGGAAGGTGTGATGG - Intergenic
1091060082 11:132452922-132452944 ATGTCCAGGGGAAAGGAGGAGGG - Intronic
1091095142 11:132813817-132813839 TTATCCCAGGGAAGGTAGGATGG - Intronic
1091293401 11:134455232-134455254 ATGTCTAAGGGAGGCTTGAAAGG - Intergenic
1094057743 12:26283940-26283962 ATGTCCAAGGGCAGGAGGGGAGG - Intronic
1095179743 12:39133825-39133847 AAGTCCAAGGCAATGTTAGAAGG + Intergenic
1100207167 12:92363421-92363443 ATGTTCAAGGGGAGGTGGAAGGG + Intergenic
1100618231 12:96248032-96248054 ATTTCCAAGGGAAAGTTGAGCGG + Intronic
1101513123 12:105410401-105410423 ATGCCCAGGGCAAGGTTGGAGGG + Intergenic
1106508542 13:30392921-30392943 ATGTGCAAGGAAAGGGAGGAGGG - Intergenic
1106777314 13:33020756-33020778 ATTACCCAGGCAAGGTTGGATGG - Intronic
1111633245 13:90870469-90870491 AAGGACAAGGGAAGGTGGGATGG - Intergenic
1113099989 13:106706953-106706975 CTTTCCAAGGGAGGTTTGGAGGG + Intergenic
1113141017 13:107149452-107149474 GTGTCCAGAGGAAGGTAGGATGG + Intergenic
1113829193 13:113281623-113281645 ATCTTGAAGTGAAGGTTGGAAGG + Intergenic
1114907626 14:27150833-27150855 AGGTCCAAGACAAGGTTGAAAGG - Intergenic
1116650503 14:47585742-47585764 ATGTATAAGGGAAGGATGAAAGG - Intronic
1117257136 14:53989459-53989481 ATGACCAAAGAAAGGTTGGATGG + Intergenic
1117827086 14:59715051-59715073 TTTTCCATGGGAAGGTGGGAGGG - Intronic
1119519093 14:75272364-75272386 TGGTTCAAGGTAAGGTTGGAAGG + Intergenic
1119685760 14:76630003-76630025 ATGGCTAATGGAAGGATGGAAGG - Intergenic
1119844926 14:77822146-77822168 ATGAGCAAGGTAATGTTGGATGG + Intronic
1121169536 14:91841955-91841977 AGGTGGAAGGGAAGGATGGATGG - Intronic
1121854730 14:97256802-97256824 ATGTCCTTGGGAAGGGTGGGGGG - Intergenic
1122028443 14:98894966-98894988 ATGTCCCAGGGAGGGCTGGCAGG + Intergenic
1202900613 14_GL000194v1_random:34452-34474 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1125015714 15:34932539-34932561 GTGTCTATTGGAAGGTTGGAGGG - Intronic
1125801473 15:42452020-42452042 AAGTACAAGGGAAGTTTGGTGGG - Intronic
1128383126 15:67127810-67127832 ATGTCCAAGGCTAGAGTGGATGG + Intronic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129701508 15:77771153-77771175 AGGTCCAGGGGAAGGTCGGGAGG - Intronic
1129769785 15:78195695-78195717 ATTTGCAAAGGAAGCTTGGATGG + Intronic
1130212518 15:81938117-81938139 ATGTCAGTGGGAAGGTGGGAGGG + Intergenic
1131793905 15:95993830-95993852 ATGTCCTTGGGAAGGCAGGAAGG + Intergenic
1132023233 15:98382775-98382797 CTGGCCATGGGAAGGATGGAGGG - Intergenic
1132234381 15:100208053-100208075 AACTCCAGGGGAAGGTGGGATGG + Intronic
1132380593 15:101363228-101363250 ATGTCCCAGGGCAGCTTTGAGGG - Intronic
1133553057 16:6877253-6877275 ATGTCCTAGAGAAAGATGGATGG + Intronic
1133950683 16:10389390-10389412 ATGCCCAAGGGAAGGAGGGGAGG - Intronic
1139159838 16:64491194-64491216 AATTACTAGGGAAGGTTGGAAGG + Intergenic
1139228389 16:65255631-65255653 ATGTTCAAGGGAAGATTCCAAGG + Intergenic
1139795838 16:69482253-69482275 ATGTCCCAGTGAACGCTGGAAGG - Intergenic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141432074 16:83975450-83975472 GTGTCCACAGGAAGGATGGATGG + Intronic
1143051598 17:4130519-4130541 ATCTCAAAGGAAAGGTTGGAAGG + Intronic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145268197 17:21390495-21390517 ATGTCCAAGGGAAGCGGGGCCGG + Intronic
1146142578 17:30379933-30379955 TTGTTCAAGGGATGGCTGGAGGG + Intronic
1148217639 17:45842042-45842064 ATTTCAAAGGGGAGGTTGGCAGG - Intergenic
1148687695 17:49509753-49509775 CTGTCCAAGGGCTGGCTGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150635303 17:66908946-66908968 GGGTCCCAGGGAAGGTGGGAAGG - Intergenic
1157707457 18:49819333-49819355 ATGTCCAAGGGCAGGAGGAATGG + Intronic
1157871448 18:51233462-51233484 ATGTCCAAGGGCAGGAGGAAAGG + Intergenic
1162086924 19:8254816-8254838 ATGTCCCAGGGATGCTGGGAGGG - Intronic
1163773895 19:19206765-19206787 ATCTGCAAGGGAGGGTTTGATGG + Intergenic
1164523006 19:28992982-28993004 ATGACCAAGGATAGTTTGGAGGG - Intergenic
1165751678 19:38264317-38264339 AAGCCCAAGGGAAGGGTGGCAGG + Intronic
1166254806 19:41595983-41596005 ATGGCCAAGGGAAGGTGGGGTGG - Intronic
1166412670 19:42566615-42566637 ATGGCCGAGGGAAGATTGGGTGG + Intergenic
1168237923 19:55075355-55075377 ATTTCCAAAGGAAGGTGGAACGG + Intronic
1168424163 19:56225217-56225239 ATTTCGAAGGGAGGGATGGATGG - Intronic
925183008 2:1829244-1829266 AGGTGTATGGGAAGGTTGGAAGG - Intronic
925591799 2:5517229-5517251 ATATTCAAGGGAAAGTTTGAAGG + Intergenic
925755261 2:7127544-7127566 ATGTCCAAGGGCAGGTGGAGAGG + Intergenic
926217411 2:10914007-10914029 CTGTCCAGGGGAGGGTTGGGGGG - Exonic
927710986 2:25325839-25325861 ATGCCCAAAGGAAGGCTGAATGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929602428 2:43212754-43212776 ATGTCCCAGGCAGGGGTGGAAGG + Intergenic
932502459 2:72195367-72195389 ATGTTCAAGGGGAGGATGGGAGG + Intronic
932606930 2:73171717-73171739 ATTTCCAAGGGAAGCTGGGTGGG - Intergenic
933925498 2:87088694-87088716 ATTTCCAAGGGAAGCTGGGTGGG + Intergenic
934506255 2:94897096-94897118 ATGTCCAAGGGCAGGAGGAAGGG + Intergenic
934601818 2:95663719-95663741 ACGTCCAAGGGAGGGGTGAAAGG - Intergenic
937393538 2:121514391-121514413 ATCTCTTAGGGAAAGTTGGAGGG - Intronic
938317587 2:130340770-130340792 GTGTACAACGGAAGTTTGGATGG + Intronic
939052602 2:137326145-137326167 ATTGTCAAAGGAAGGTTGGATGG - Intronic
939143764 2:138388263-138388285 ATGTCCCATGGAAGGTTACATGG + Intergenic
939182994 2:138825896-138825918 AAGTGCACGGGAAGGCTGGAGGG - Intergenic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
940587392 2:155670563-155670585 ATGCTTAAGGGAAGGTTGTAGGG + Intergenic
940711438 2:157167145-157167167 ATGTCCAAGGGCAGGAGGGATGG - Intergenic
942233394 2:173880616-173880638 TTGTTCAAGGGCAGGTTGAAGGG + Intergenic
942629232 2:177938111-177938133 GAGTGAAAGGGAAGGTTGGAAGG + Intronic
943155477 2:184169598-184169620 ATGTCCAAGGGCAGGGGGAATGG - Intergenic
945446410 2:209943286-209943308 ATGGTCATGGGAAGCTTGGAGGG - Intronic
946880207 2:224170020-224170042 CTGTGCAATGGAAGGCTGGAAGG + Intergenic
947631438 2:231656003-231656025 ATTTCCGAGGGAAGTTTGCAGGG - Intergenic
948160865 2:235822881-235822903 ACATCCGAGGGAAGGATGGATGG + Intronic
948206689 2:236166494-236166516 ATGTCCAAATGACGGTGGGAAGG - Intronic
1169451340 20:5714311-5714333 AGGTCAAAAGGAAGGTTGCAGGG - Intergenic
1170156121 20:13271201-13271223 GTGTCCAAGGCAAGTTTAGAGGG - Intronic
1170391874 20:15884117-15884139 ATGCCCAGGGGATGGATGGATGG + Intronic
1171465322 20:25323909-25323931 ATGACCAACGGAACGTTGGGTGG + Intronic
1171893782 20:30742133-30742155 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
1172181109 20:33004186-33004208 ATCTCCAAGGACAGGGTGGAGGG + Intronic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1173377992 20:42507125-42507147 ATATCCATGGGCAGGTTAGAAGG + Intronic
1173827044 20:46054816-46054838 AAGGCCAAGGGAAGGAAGGAAGG - Intronic
1175296729 20:57913740-57913762 ATGTGCATGGGCAGGGTGGACGG + Intergenic
1175405312 20:58722278-58722300 AGGGCCAAGCGAAGATTGGATGG - Intergenic
1175625753 20:60487102-60487124 ATGGCCAAGGCAGGGTTGGCCGG + Intergenic
1176420170 21:6507824-6507846 ATGTCCAAGGGCAGGGGGAACGG - Intergenic
1176619988 21:9049230-9049252 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1177627389 21:23680610-23680632 ATATCCAAGGGAAAATTGGATGG - Intergenic
1179268003 21:39822385-39822407 ATATCCAAGGCACAGTTGGAGGG - Intergenic
1179306407 21:40157384-40157406 AGGTCCAAGGCAGGGTGGGAAGG + Intronic
1179695662 21:43116144-43116166 ATGTCCAAGGGCAGGGGGAACGG - Intergenic
1181646883 22:24236190-24236212 ATTTCGCAGGGACGGTTGGAAGG - Intronic
1181668253 22:24412973-24412995 CCGTCCCAGGGAAGGTTGGCTGG - Intronic
1183036270 22:35143160-35143182 ATCTCCAAGGCAAGGTGGTAAGG + Intergenic
1185242344 22:49753420-49753442 ACGTCCATGGGAAGGAAGGAGGG + Intergenic
949812478 3:8020780-8020802 ATGTGCAAGGGATGGTTGGGTGG - Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
953534287 3:43765471-43765493 ACCTCCAAGAGAAGGTTGGAAGG - Intergenic
955611848 3:60765896-60765918 ATGTCCAAGGGCAGGAGGGATGG - Intronic
957750406 3:84407949-84407971 ATGTCCAAGGGCAGGAAGAACGG + Intergenic
957942591 3:87023558-87023580 GAGTCCAAGGGGTGGTTGGAAGG - Intergenic
958612926 3:96450529-96450551 ATATCCAAGGTAAGGTAGAAAGG - Intergenic
959289116 3:104449960-104449982 ATGTCCAAGGGCAGGATGAATGG + Intergenic
960155329 3:114292624-114292646 GTGTCCAAGGGAAGGTGCCAAGG - Intronic
960467319 3:118013451-118013473 ATGCCCAAGTCTAGGTTGGAGGG + Intergenic
960801510 3:121545331-121545353 GCGTCCAGGGGAAGGCTGGAAGG - Intronic
960807748 3:121600360-121600382 CTGTGAAAGGGAAGGTTGTAGGG - Intronic
961367359 3:126408584-126408606 ATGTCCAAGGGCAGGAAGGATGG - Intronic
961739770 3:129025936-129025958 AGGCACAAGGGAAGCTTGGAAGG - Intronic
962366948 3:134793220-134793242 TTGTCCAGGGGAAGGTAGTATGG + Intronic
963330065 3:143904332-143904354 ATGACCAAGGGATGGCAGGAAGG - Intergenic
963472414 3:145757741-145757763 ATGTCTAAGGATAGGTAGGATGG + Intergenic
964270901 3:154955587-154955609 TAGTCCAAAGGAAAGTTGGATGG - Intergenic
969462916 4:7338226-7338248 ATGTCGGATGGAAGGATGGATGG + Intronic
972320178 4:37966079-37966101 ATGCCTGAGGGAAGCTTGGAAGG + Intronic
972942793 4:44217746-44217768 ATGTCCAAGGGCAGGAAGAATGG - Intronic
973151262 4:46891260-46891282 ATGTCCAAGGGAAAGATTCAAGG + Intronic
973274156 4:48291374-48291396 ATTTCCAAGGGAAGCTGTGATGG + Intergenic
974764734 4:66329035-66329057 ATGTTCAGGGGGAGGTAGGAAGG - Intergenic
976333238 4:83855809-83855831 AAGTGCAAGGGAAGTTTGTATGG + Intergenic
977012352 4:91653641-91653663 ATGTCCAAGGGAAGAAAGAAAGG - Intergenic
977625503 4:99185728-99185750 ATGTCCAAGGGCAGGAAGAATGG - Intergenic
977694176 4:99948965-99948987 TTGGCCAAAGGAAAGTTGGAAGG - Intronic
979416768 4:120450904-120450926 ATGTACAAATGAATGTTGGAGGG + Intergenic
981135538 4:141206957-141206979 ATGTCCAAGGGCAGGAAGAATGG + Intronic
984314988 4:178117858-178117880 ATTTCCCAGGCAAGGTTGGAAGG - Intergenic
1202771190 4_GL000008v2_random:209118-209140 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
985940213 5:3129216-3129238 GTGTCCAAAGGAAGGTTGGCAGG - Intergenic
986436876 5:7742866-7742888 ACATCCAAGGAGAGGTTGGATGG - Intronic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
987217435 5:15751698-15751720 ATGTCAAAGGGAGGGGTGCAAGG + Intronic
987238674 5:15969911-15969933 ATAGCCAAGGAAAGGTTGGGTGG - Intergenic
987384692 5:17318265-17318287 ATGGACAAGGGATGGATGGACGG - Intergenic
988088383 5:26502383-26502405 ATAACAAAGGGAAGGTTGGTGGG + Intergenic
988455587 5:31384418-31384440 AGGTCCAGGGGAAGGTTTGCAGG + Intergenic
990325873 5:54674860-54674882 CTGTCCAAAGGAAGGTGGAAGGG + Intergenic
993306333 5:86279762-86279784 ATGTCCTAGGGCAGGAAGGAAGG - Intergenic
993919004 5:93776836-93776858 ATTTCCAAGTGAAGTTTAGATGG + Intronic
995033373 5:107505832-107505854 ATCTCCAAGAGAAGGTGGGGGGG - Intronic
997431435 5:133843769-133843791 ATGTGCAAGGGATGGACGGAGGG + Intergenic
998616782 5:143749680-143749702 ATTTCCCAGGCAAGGTTGGAAGG + Intergenic
999777624 5:154823593-154823615 CTGCCCAAGGGAAGGGAGGAGGG + Intronic
1000132756 5:158315682-158315704 ATGTCTATAGGAAGGTGGGAAGG + Intergenic
1000715393 5:164637460-164637482 ATGTGCAAGTGAAGGTTGGGTGG - Intergenic
1003638312 6:7854966-7854988 ATGTCCAAGGCAGGGTAAGAGGG - Intronic
1003719647 6:8686387-8686409 ATGTTACAGGGAAGGTTGGAGGG + Intergenic
1004401082 6:15289169-15289191 AAGTCCAAGGGAAGCATCGAGGG + Intronic
1004894590 6:20135576-20135598 ATGTCCCAGTAAAGGTAGGATGG + Intronic
1008093118 6:47312216-47312238 AAGTCCAAAGGTAGGATGGAGGG - Intergenic
1008884250 6:56414710-56414732 ACGTCCAAAGGAAGGCTGCATGG - Intergenic
1009636478 6:66271594-66271616 ATTTCCAAGAGAAGTTTGTAAGG + Intergenic
1009890703 6:69677526-69677548 AAGGGCAAGGGAAGGTTGAAAGG + Intronic
1011198831 6:84812083-84812105 ATGTCCAAGGCCAGGGTGTAGGG + Intergenic
1011227128 6:85119828-85119850 ATGTGAAAGGGAATGTTTGAGGG - Intergenic
1011638114 6:89393655-89393677 ATGTTCAAGGAAATGTTGGAGGG - Intronic
1014623994 6:123703674-123703696 ATGTCTATGGGAAGGCAGGAAGG + Intergenic
1014730428 6:125025537-125025559 ATTTCCAAAGGAAGGAAGGAAGG + Intronic
1016793826 6:148096160-148096182 AAATCCAAGGGAAAGCTGGATGG + Intergenic
1017748082 6:157465050-157465072 ATGTCACAGGGTAGGTTAGATGG - Intronic
1018011846 6:159677966-159677988 AAGACCAAGGCAAGATTGGAGGG + Exonic
1018969900 6:168520047-168520069 ATGGTTGAGGGAAGGTTGGACGG + Intronic
1019461998 7:1164756-1164778 ATGTCCAAGGGCAGGAGGAATGG + Intergenic
1022255309 7:28650594-28650616 ATTTCCTATGGAAGGTTGGGGGG - Intronic
1022979265 7:35588797-35588819 ATGTCCAAGGGCAGGAGGAATGG - Intergenic
1023998383 7:45175752-45175774 AAGGCCAAAGGAAGGCTGGAGGG - Intronic
1024107394 7:46107363-46107385 ATTTCCAAGGGCAGAGTGGACGG + Intergenic
1024168487 7:46759378-46759400 ATTTACAAGGGATGGTGGGAAGG + Intronic
1026165329 7:67904142-67904164 ATGTCCAAGGGCAGGAGGAAAGG + Intergenic
1030231322 7:107210720-107210742 CTGTCCAAGGGAAGTGTGAAGGG + Intronic
1031478503 7:122250800-122250822 TTCTCCAAAGGAGGGTTGGAGGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1033870817 7:145751677-145751699 CTGTCTCAGGGAAGGTTGCAAGG - Intergenic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1038813615 8:30878337-30878359 ATGCCCAAGGGAAGGACGGCTGG + Intronic
1038938503 8:32278676-32278698 GTGTCCTAGGGAAGGTAAGAGGG - Intronic
1039414033 8:37378571-37378593 ATGTCCAAGGGCAGGAGGGGAGG + Intergenic
1039567203 8:38560096-38560118 ATGTCCAAGGGAAGGCACCAGGG - Intergenic
1042801467 8:72722425-72722447 ATATCCCAGGGAAGGAGGGAAGG - Intronic
1043276426 8:78400880-78400902 ATGGCCATGGGATGGATGGATGG + Intergenic
1044545638 8:93456127-93456149 ATGCCAAAGGGAAGGTGGTAAGG + Intergenic
1044774006 8:95668918-95668940 ATGTCCCAGGAGATGTTGGAAGG - Intergenic
1045036175 8:98178221-98178243 ATGGGCAGGGGAAGGGTGGAAGG - Intergenic
1046299182 8:112263764-112263786 ATCTCTAATGGAAGGCTGGAAGG - Exonic
1046342943 8:112882422-112882444 ATGTGCAAAGGAAGCTTGTAGGG - Intronic
1046428447 8:114087557-114087579 ATGTCCAAGCTAAGTTTTGAAGG - Intergenic
1046661398 8:116951439-116951461 ATAGCCAAGAGAAGGTTGGGAGG - Intronic
1046661465 8:116952045-116952067 ATAGCCAAGAGAAGGTTGGGAGG + Intronic
1047160221 8:122369821-122369843 ATGTCCAAGGGCAGGAGGGTGGG + Intergenic
1047944215 8:129858813-129858835 ATACCTAAGGGAAGGTTGTATGG - Intronic
1050899127 9:10922924-10922946 ATTTCCAAGGGAAATTTGGTAGG - Intergenic
1050946754 9:11531253-11531275 ATGTTCAAGGGAATGATTGAAGG + Intergenic
1053525343 9:38824601-38824623 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054197573 9:62049029-62049051 ACTTCCAGGGAAAGGTTGGATGG - Intergenic
1054354849 9:64050558-64050580 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1054424283 9:64991406-64991428 ATGTCCAAGGGAAGCCTTAAAGG - Intergenic
1054640837 9:67539673-67539695 ACTTCCAGGGAAAGGTTGGATGG + Intergenic
1055772819 9:79735784-79735806 ATGTCCAAAGCAAGGATGGAAGG - Intergenic
1057304341 9:93903657-93903679 TTGTCCCTGGGCAGGTTGGAAGG - Intergenic
1060024540 9:120160183-120160205 ATGAGAAAGGGAAAGTTGGAGGG + Intergenic
1060801278 9:126547360-126547382 ATGACCAAGGGAAGGCAGGAGGG - Intergenic
1060878885 9:127103871-127103893 ACTTCCACGGGAAGGCTGGAGGG - Intronic
1061593760 9:131615472-131615494 CTGTGCAGGGGACGGTTGGAGGG + Intronic
1062564782 9:137159344-137159366 ATGACCGAGAGAAGGTTGGTGGG - Intronic
1203743187 Un_GL000218v1:19688-19710 ATGTCCAAGGGCAGGAAGAAGGG - Intergenic
1203566917 Un_KI270744v1:99827-99849 ATGTCCAAGGGCAGGAAGAAGGG + Intergenic
1187866974 X:23731778-23731800 ATATCCAAAGGAAGTATGGAAGG + Intronic
1188125480 X:26363091-26363113 ATGTGTAAGGGAAGGAAGGATGG - Intergenic
1189194771 X:39143700-39143722 AGGTGCAAGGGAAGGAGGGAAGG - Intergenic
1189785653 X:44556771-44556793 ATGTCCAAGGGCAGGAGGAATGG + Intergenic
1198255291 X:134919116-134919138 ATGTCCTAGGGAAGGGTGGATGG - Intergenic
1199381682 X:147179727-147179749 ATTTCAAAGGCAAGGCTGGATGG - Intergenic
1201147770 Y:11074340-11074362 ATGTCCAGAGGAGGGTTTGAGGG - Intergenic
1201524682 Y:14919369-14919391 AGGAACAAGGGAAGGTAGGAAGG + Intergenic