ID: 1145267850

View in Genome Browser
Species Human (GRCh38)
Location 17:21389082-21389104
Sequence GCACAACTGCAGTTTAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 125}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145267850_1145267864 30 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267864 17:21389135-21389157 TTTCAGAATTCCAGAGGACGGGG 0: 1
1: 0
2: 0
3: 10
4: 159
1145267850_1145267857 -3 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267857 17:21389102-21389124 TGCGGGGAGCTTGCCTGGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 190
1145267850_1145267858 4 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267858 17:21389109-21389131 AGCTTGCCTGGCCAGGTGTTAGG 0: 1
1: 0
2: 0
3: 23
4: 196
1145267850_1145267861 24 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267861 17:21389129-21389151 AGGCTGTTTCAGAATTCCAGAGG 0: 1
1: 0
2: 3
3: 24
4: 197
1145267850_1145267856 -8 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267856 17:21389097-21389119 AGTTGTGCGGGGAGCTTGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 88
1145267850_1145267863 29 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267863 17:21389134-21389156 GTTTCAGAATTCCAGAGGACGGG 0: 1
1: 0
2: 1
3: 28
4: 260
1145267850_1145267862 28 Left 1145267850 17:21389082-21389104 CCCCATTTAAACTGCAGTTGTGC 0: 1
1: 0
2: 2
3: 8
4: 125
Right 1145267862 17:21389133-21389155 TGTTTCAGAATTCCAGAGGACGG 0: 1
1: 0
2: 5
3: 48
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145267850 Original CRISPR GCACAACTGCAGTTTAAATG GGG (reversed) Intronic
905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG + Intergenic
906461910 1:46041068-46041090 TCTTAACTGCAGTTTCAATGAGG - Exonic
907264041 1:53244570-53244592 CTACAACTGCAGTTTGAAAGAGG - Intergenic
910750496 1:90624214-90624236 ACAAAAATGCACTTTAAATGGGG - Intergenic
912101359 1:106210183-106210205 TCATAACTGCAGATGAAATGAGG - Intergenic
921577676 1:216855808-216855830 GCACAACTGCATTTTCAAGCGGG - Intronic
1064128813 10:12689402-12689424 GTTCAAATGCATTTTAAATGTGG - Intronic
1064634890 10:17355125-17355147 AAGCAACTGCAGTTTAAATCTGG - Intronic
1068597212 10:58915828-58915850 GCACAACTTAAGTATAAATTGGG + Intergenic
1068813082 10:61278631-61278653 TAACAACTGCAGTTTGAATGTGG - Intergenic
1069810739 10:71157747-71157769 GCAAAACTGCAGTTGAAACATGG + Intergenic
1070278203 10:75028624-75028646 GTACAAATTCAGTTTAAATCCGG - Exonic
1075028479 10:119004344-119004366 GGATAACTGGAATTTAAATGAGG + Intergenic
1077072027 11:679408-679430 GCACAACTGCAGTCAAAAGCAGG + Intronic
1079582629 11:22085118-22085140 ACAAATCTGCAGTATAAATGGGG - Intergenic
1080125757 11:28731788-28731810 GCCCAACTGAAGTGGAAATGTGG + Intergenic
1082109987 11:48263950-48263972 GCACAACAGCTGTGTACATGAGG - Exonic
1085060059 11:73437444-73437466 GCACCACTGCACTTTAGATTGGG - Intronic
1086887244 11:92220428-92220450 GCACCACTGCCGTTCCAATGAGG - Intergenic
1088452263 11:109994789-109994811 GCACACTTGCCGTTTAAATAGGG - Intergenic
1088573324 11:111244237-111244259 GGACATCCGTAGTTTAAATGAGG - Intergenic
1095214224 12:39529136-39529158 GCAGAACTGGAATTTGAATGCGG + Intergenic
1096420495 12:51453251-51453273 CCACAACTGCAGGGTTAATGAGG + Intronic
1102663658 12:114551061-114551083 GCACAAATGCAGGGTAAATGGGG + Intergenic
1103422102 12:120794692-120794714 GGACAACTGCTGTTTTAAAGAGG + Intronic
1104092929 12:125530820-125530842 GCACATCATTAGTTTAAATGAGG - Intronic
1104564820 12:129871122-129871144 CCACACCTGCAATTTCAATGTGG + Intronic
1105007164 12:132728777-132728799 GCAAAACTGCATTTTAACAGCGG - Intronic
1105920977 13:24963148-24963170 GCACGACTGCAGAAGAAATGGGG + Intergenic
1109179931 13:59201714-59201736 GCACAACAGGTGTTAAAATGTGG - Intergenic
1115386883 14:32807980-32808002 GCAAAACTGCTCTTGAAATGCGG - Intronic
1116461476 14:45180213-45180235 ATACAACAGGAGTTTAAATGTGG + Intronic
1118667264 14:68084537-68084559 ACACAACTGGAGTTTAAATATGG + Intronic
1118821316 14:69347959-69347981 GCACATCTGCAGTATGACTGGGG - Exonic
1119528551 14:75342565-75342587 GCACAACTTCAGTTTATGTCTGG + Intergenic
1120440680 14:84534845-84534867 GAACCACTGCAGGTTAAATCTGG - Intergenic
1123807481 15:23889438-23889460 GCATAACTGCATAGTAAATGTGG + Intergenic
1124132168 15:27000561-27000583 TCACAACAGCAGTACAAATGGGG - Intronic
1128152311 15:65371047-65371069 GCCCAACAGTGGTTTAAATGTGG - Intronic
1129349128 15:74944171-74944193 GCAGAACTGTAGTTTAATAGCGG - Intergenic
1129673606 15:77620707-77620729 CCAAAACTGCAGTTTCACTGGGG + Intronic
1130949394 15:88573551-88573573 GGACTTCTGCAGTTGAAATGAGG - Intergenic
1131242559 15:90759549-90759571 GCACCACTGCAGTTTAACCTGGG + Intronic
1131880759 15:96859647-96859669 GCTCCACTGCAGTCTCAATGAGG - Intergenic
1138034986 16:53595063-53595085 TCCCATCTGCAGTTTAAAAGTGG + Intergenic
1139213510 16:65104748-65104770 TCACAACAGCAATATAAATGGGG - Intronic
1139905462 16:70362618-70362640 GCACCACTGCACTCTAGATGGGG - Intronic
1141587036 16:85041146-85041168 GCACAACTTCAGTTTCTATTTGG - Intronic
1145267850 17:21389082-21389104 GCACAACTGCAGTTTAAATGGGG - Intronic
1149653855 17:58299056-58299078 CCACAGCTGCAGTGCAAATGGGG + Intergenic
1152876417 17:82789098-82789120 GGACAAGAGCAGTTTGAATGTGG + Intronic
1155367993 18:25068096-25068118 ATACAACTGCAGTTTAAATTCGG - Intronic
1155788164 18:29928154-29928176 GCACAACTGCTGTTGAATTTAGG - Intergenic
1157167261 18:45369399-45369421 GTACATCTGCATTTTAAAAGAGG + Intronic
1158051112 18:53221199-53221221 GTAAATGTGCAGTTTAAATGTGG + Intronic
1163100998 19:15096453-15096475 GCACAACTGCACTCCAGATGAGG + Intergenic
925912407 2:8582435-8582457 GCACAACTGCAGGAGAAAGGAGG + Intergenic
930355871 2:50319099-50319121 GCAAAACTGGAGTTTAAATGGGG + Intronic
931154897 2:59616767-59616789 GCCCAACAGCAGATTAAAAGTGG - Intergenic
931362429 2:61589286-61589308 GAACAACTGGATTTTAAAAGCGG - Intergenic
939869461 2:147510731-147510753 GCACAACCTCAGGGTAAATGAGG - Intergenic
942078473 2:172379108-172379130 ACAGAACTGCAGTTTGAAGGTGG + Intergenic
942245782 2:174006488-174006510 GGTCAACTGTAGTTAAAATGAGG - Intergenic
943472811 2:188315917-188315939 GCAAAACTGCAGATTAAGGGAGG + Intronic
943700297 2:190981887-190981909 GCAAAACTGCAGATCAAAAGAGG + Intronic
945305910 2:208258424-208258446 GCACCACTGCACTCTAACTGGGG + Intronic
945316228 2:208373633-208373655 TCACCACTGCAATTTAAATTTGG - Intronic
948636514 2:239341283-239341305 GAACACCTGCAGTCTCAATGTGG - Intronic
1169547967 20:6670271-6670293 GCACCACTGTATTTTCAATGCGG - Intergenic
1170170286 20:13403357-13403379 GCATAACTGCAGTGTAAATGGGG + Intronic
1172056190 20:32155737-32155759 GCAGGACTGCAGTTGAGATGTGG + Intronic
1172540735 20:35713820-35713842 GCACAACTGCACTCCAAATTGGG + Intronic
1173213934 20:41061723-41061745 GAACAACTGTATTTTTAATGAGG - Intronic
1173552779 20:43944938-43944960 GCACAAATGCAGTTAAACTAGGG - Intronic
1175275535 20:57767294-57767316 GTACAACTTCACTTAAAATGTGG + Intergenic
1176740193 21:10594669-10594691 GCACGACTGCAGAAGAAATGGGG - Intronic
1178320242 21:31599730-31599752 GCCCAACTGCAGTGTTCATGAGG + Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956856720 3:73282436-73282458 GCACAACTTCAGTCTAATTGAGG - Intergenic
961488585 3:127234801-127234823 GCACTTCTGCAGTTACAATGAGG - Intergenic
964133811 3:153320765-153320787 GGAAATCTGCAGTTTAAAGGAGG + Intergenic
964285815 3:155116897-155116919 GCACAACTGAATTCTAAATATGG + Exonic
965975495 3:174615172-174615194 GCCCAGCTGCATTTTAAATGTGG + Intronic
973952177 4:56027248-56027270 TCACAGCTGCAGTTTAGATCAGG + Intronic
975147544 4:70985843-70985865 GCTCAACTGTAATTTAAATTTGG + Intronic
980215395 4:129846200-129846222 TCAGCACTGCTGTTTAAATGTGG - Intergenic
981577591 4:146221372-146221394 GGGTAACTGCATTTTAAATGTGG + Intergenic
982580161 4:157167386-157167408 GGAAAACTGAAGATTAAATGTGG + Intronic
983284422 4:165721432-165721454 GGACAACTACTGTTTAAAAGAGG + Intergenic
983311813 4:166074334-166074356 GCATAACTGCAGAGTTAATGGGG + Intronic
984331210 4:178321450-178321472 GCACAGCTGCAGCAGAAATGTGG - Intergenic
989209128 5:38842837-38842859 GCATAACTGAAGTTTGAATTCGG + Intergenic
990958884 5:61372186-61372208 GCATAAATGCCATTTAAATGTGG + Intronic
993077754 5:83255514-83255536 ACACAACTTCAGTTTATTTGTGG + Intronic
993440555 5:87951744-87951766 CCATAACTACAGTTTAAATAAGG + Intergenic
994943386 5:106354391-106354413 GTACAAGTGCTGTTTAAAAGTGG - Intergenic
995415937 5:111913273-111913295 GCACTACTTCATTTTAAAAGCGG + Intronic
995845750 5:116491960-116491982 TCTCAACTACAGTTTAAAAGTGG - Intronic
996023724 5:118620288-118620310 GAAGAACTGCAGTTCAAATGGGG + Intergenic
1003375667 6:5574774-5574796 GAACAACTGTAATTTAAATAAGG - Intronic
1004021947 6:11783857-11783879 GCTGAGCTGCATTTTAAATGAGG - Intronic
1010435661 6:75827071-75827093 GCACATGAGCAGTTTCAATGAGG + Intronic
1011459533 6:87589209-87589231 GCAAAATTGCAGTATAAATGTGG - Intronic
1012373083 6:98530294-98530316 GGACAACTGGAGTTCACATGTGG + Intergenic
1012678550 6:102149331-102149353 GTACAATTGCAGTTTAATTTAGG - Intergenic
1013834829 6:114322187-114322209 GCGCAACTGAAATATAAATGTGG + Intronic
1015075883 6:129157296-129157318 GGACAACTTTATTTTAAATGTGG - Intronic
1017709118 6:157150419-157150441 GCTCACCAGGAGTTTAAATGGGG + Intronic
1019036522 6:169064616-169064638 GAACATCTGCAGTTTAAACCAGG - Intergenic
1023758604 7:43443519-43443541 GCACTAATGCATTTGAAATGGGG + Intronic
1024114615 7:46180841-46180863 TTCCAAGTGCAGTTTAAATGAGG + Intergenic
1028201217 7:87964120-87964142 AAACAACTGCACTCTAAATGAGG - Intronic
1031427712 7:121626650-121626672 GCACAATTGGAATTTGAATGGGG - Intergenic
1032760604 7:134937813-134937835 TCTCCACTGCAGTTTAACTGTGG + Intronic
1033528399 7:142239997-142240019 TCACAACTTCATATTAAATGTGG - Intergenic
1038015672 8:23512637-23512659 TTACAACTGCCTTTTAAATGAGG + Intergenic
1039223405 8:35360623-35360645 ACACAGCTGTAGTTGAAATGTGG - Intronic
1039634050 8:39143941-39143963 GCAACACTGCAGCTTAATTGGGG - Intronic
1039821918 8:41142160-41142182 GGACACCTGCAGTCCAAATGAGG + Intergenic
1041194012 8:55382330-55382352 GCACAACTGCTTTTGAAAAGTGG - Intronic
1041356595 8:57006856-57006878 GGACAATTGCAGTATAAATATGG - Intergenic
1043326637 8:79060436-79060458 CCACAACTGCATGTGAAATGGGG - Intergenic
1043958790 8:86391325-86391347 ACAGAACTGAAGTTTAACTGAGG - Intronic
1046428476 8:114088010-114088032 GCACAACTGCAAATTATATTGGG + Intergenic
1047048661 8:121083776-121083798 AAACAGCTGCAGTTTGAATGTGG + Intergenic
1048607007 8:135979506-135979528 GCAGAGCTGGTGTTTAAATGGGG + Intergenic
1048946459 8:139452962-139452984 GCAAAACTCAAGTCTAAATGTGG - Intergenic
1049154989 8:141060906-141060928 CCAGGCCTGCAGTTTAAATGAGG - Intergenic
1051664970 9:19460393-19460415 GCACAAACGCAGGGTAAATGGGG - Intergenic
1054878466 9:70121037-70121059 ACACAACTGGAGTGCAAATGTGG + Intronic
1186612790 X:11154628-11154650 TTATAAGTGCAGTTTAAATGAGG + Intronic
1188236893 X:27742245-27742267 GCACAAGCGCAGGGTAAATGGGG + Intronic
1188391169 X:29622126-29622148 CCAGAACTGAATTTTAAATGGGG + Intronic
1192056634 X:67780375-67780397 GCTCAGCTGGAGTTTAACTGTGG - Intergenic
1195637837 X:107138048-107138070 GCACAAAAGCAATTTAATTGAGG + Intronic
1196035839 X:111143836-111143858 ACACAATAGTAGTTTAAATGAGG - Intronic