ID: 1145273228

View in Genome Browser
Species Human (GRCh38)
Location 17:21415560-21415582
Sequence CCAGCGGATGTCCACACAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145273228_1145273233 5 Left 1145273228 17:21415560-21415582 CCACCTGTGTGGACATCCGCTGG 0: 2
1: 0
2: 1
3: 4
4: 99
Right 1145273233 17:21415588-21415610 CATGCTGCTCATCTTCTCGCTGG 0: 2
1: 0
2: 1
3: 11
4: 118
1145273228_1145273234 22 Left 1145273228 17:21415560-21415582 CCACCTGTGTGGACATCCGCTGG 0: 2
1: 0
2: 1
3: 4
4: 99
Right 1145273234 17:21415605-21415627 CGCTGGCCTTCCTTGCCTCCTGG 0: 2
1: 0
2: 1
3: 25
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145273228 Original CRISPR CCAGCGGATGTCCACACAGG TGG (reversed) Exonic
903447905 1:23434187-23434209 CCATCGGAAGTCCACATAAGGGG + Intronic
911574071 1:99553555-99553577 CCACCTGATGTCCCCACATGGGG + Intergenic
915897021 1:159819988-159820010 CAAGGGGATGTCAACACAGCTGG - Intergenic
915980724 1:160418334-160418356 CCAGGTGATGTCCACACCGCTGG + Intronic
916213228 1:162374950-162374972 CCAGCGGATAGCCAAACCGGCGG + Intronic
919632936 1:199976653-199976675 CCAGCATATTTCCACACACGTGG - Intergenic
921874345 1:220177064-220177086 CCAGCAGGTGTCTGCACAGGTGG - Intronic
1062931121 10:1353335-1353357 CCAGCGGATGTTCGCTAAGGAGG - Intronic
1064395370 10:14977571-14977593 CCAGTGGGTGTACACACATGGGG + Intronic
1068066941 10:52143614-52143636 CCAGCGGACTTCCCCTCAGGTGG - Intronic
1070020418 10:72579703-72579725 CCACAGAATGTCCACATAGGTGG + Intronic
1074695001 10:116042306-116042328 AAGGAGGATGTCCACACAGGGGG - Intergenic
1077606495 11:3616178-3616200 CCCGGACATGTCCACACAGGAGG - Intergenic
1080722406 11:34862714-34862736 CCAGCTGATGTCCACGTAGCTGG - Intronic
1081061322 11:38481545-38481567 CCAGCGGAGGAACACACAAGTGG + Intergenic
1084436055 11:69140781-69140803 CCAGTTGATGCCCACACAGCTGG + Intergenic
1089708311 11:120297097-120297119 CAACCAGATGTCCACATAGGAGG + Intronic
1093528435 12:20133007-20133029 CCAGCAGTTGTCCAGAGAGGAGG + Intergenic
1098231554 12:68376340-68376362 CCAGAGGGATTCCACACAGGAGG - Intergenic
1101642745 12:106600503-106600525 CCAGGGGCTGGCTACACAGGAGG - Intronic
1106176480 13:27336589-27336611 CCGGCTGCTGTCCCCACAGGAGG + Intergenic
1113101628 13:106726113-106726135 CCAGGGTATGTCCCCATAGGAGG + Intergenic
1113575052 13:111389359-111389381 CCAGCGCCCGTCCGCACAGGAGG + Intergenic
1118443122 14:65829654-65829676 CCAGCTGAGGACCACCCAGGAGG + Intergenic
1122378673 14:101286287-101286309 CCCAGGGATGCCCACACAGGAGG - Intergenic
1123042748 14:105497055-105497077 ACAGCGGATGTCCTCAGAGCCGG + Intronic
1124553140 15:30700716-30700738 CCAGCAGATGCCAACACAGCTGG + Intronic
1124678103 15:31704954-31704976 CCAGCAGATGCCAACACAGCTGG - Intronic
1125039816 15:35172254-35172276 CCAGAGATTGTCCACATAGGTGG - Intergenic
1127257283 15:57303008-57303030 CCAGAGGATGTGCTTACAGGAGG - Intergenic
1128368752 15:67023971-67023993 CCAGCTGAGGGCTACACAGGAGG - Intergenic
1132045977 15:98563034-98563056 CCAGGGCCTGTCCACTCAGGGGG - Intergenic
1132504097 16:298138-298160 ACAGCCCATGTCCACACAGCGGG + Exonic
1140409938 16:74735348-74735370 CAAGCTGAAGTCCACAGAGGTGG + Intronic
1142170502 16:88619638-88619660 CCAGCTGAGGTCCAGAGAGGCGG - Intronic
1142814587 17:2415209-2415231 CCAGCAGTTGTGCACATAGGAGG - Intronic
1144515616 17:15915901-15915923 CCAAGGGATGTCCACATAGCTGG - Intergenic
1144523246 17:15968370-15968392 TCACCGTATGTACACACAGGGGG - Intronic
1145273228 17:21415560-21415582 CCAGCGGATGTCCACACAGGTGG - Exonic
1145311421 17:21703004-21703026 CCAGCGGATGTCCACACAGGTGG - Exonic
1147526854 17:41232941-41232963 GCAGCAGCTGTACACACAGGTGG - Exonic
1150612924 17:66748457-66748479 CCAAAGGATGTCCATAGAGGTGG + Intronic
1150984035 17:70175260-70175282 CCAGCGAATGTCCACACACGTGG - Exonic
1152586384 17:81191332-81191354 GCAGCGCATGTCCCCCCAGGAGG - Exonic
1160657547 19:281329-281351 CCAGCTGAGGCCCACCCAGGTGG - Exonic
1162588489 19:11576171-11576193 CCAGCTGATGTCCACATGGCTGG - Intronic
1163551890 19:17969912-17969934 CCAGCGGATGTTCAGGCAGTGGG + Intronic
1166247600 19:41540107-41540129 TCAGCGGAGGAACACACAGGCGG + Intergenic
1166806997 19:45493282-45493304 CCAATGGCTGTCCACAGAGGTGG + Exonic
1167261584 19:48461960-48461982 CCAGCGCACGTCCACGCATGTGG - Exonic
925838122 2:7965472-7965494 CCAGCGGATGTGGATACAGCCGG - Intergenic
926006938 2:9379600-9379622 CCAGCTGTTGTCCCCTCAGGAGG + Intronic
929971448 2:46580602-46580624 CCAGCAGATGTCAGCACATGTGG + Intronic
930297973 2:49579044-49579066 TCAGCGGAGGAACACACAGGTGG - Intergenic
942512905 2:176721983-176722005 CCAGAGGATGACCACCCATGAGG + Intergenic
946374179 2:219298186-219298208 CCAGGAGATGTCCTAACAGGGGG - Intronic
948775821 2:240288294-240288316 CCAGCTGGTGTCCACAGGGGTGG + Intergenic
948797558 2:240412612-240412634 CCAGTGGCTGTCCACCCTGGTGG + Intergenic
1168739631 20:176657-176679 CCAGCGGTTGTTCACTAAGGAGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1174686972 20:52465456-52465478 CCAGAGGATGCAGACACAGGAGG - Intergenic
1176215814 20:63947251-63947273 CCAGTGCCTGTCCACACAGCAGG - Intronic
1178425989 21:32478750-32478772 ACAGTGGATGCCCAGACAGGGGG - Intronic
1178887418 21:36494930-36494952 CCAGACGAGGACCACACAGGAGG + Intronic
1179558029 21:42193172-42193194 CCAGAGGAGGTCCCCGCAGGAGG + Intergenic
1180009540 21:45040487-45040509 CCAGGGGAACTCCACACAGAAGG - Intergenic
1182294786 22:29306604-29306626 CCAGGGGAGGTCCACCCGGGAGG + Intronic
1183540738 22:38427968-38427990 CCAGCGCGTGTCCACGCAGGTGG + Exonic
1184447230 22:44555933-44555955 CCACCTGTTGTCCACACAGGTGG + Intergenic
1184879410 22:47295492-47295514 GCAGCAGCTGTCCACACAGAGGG + Intergenic
949886680 3:8700767-8700789 ACAGTGGATGTACACACATGGGG - Intronic
953737808 3:45511305-45511327 TCAGGGGATGTCCACATGGGAGG - Intronic
955215390 3:56981204-56981226 CATGCCGATGTCCACACAGCTGG + Intronic
965535042 3:169814403-169814425 CCGGCGGAGGAGCACACAGGTGG - Intergenic
968705897 4:2077365-2077387 CCTGTGGATGTACACCCAGGAGG - Intronic
970962484 4:21889148-21889170 CCACAGGTTATCCACACAGGTGG + Intronic
980736376 4:136895021-136895043 CCAGAGGATGCCCAGACATGTGG + Intergenic
984769179 4:183422701-183422723 CCAGCGGTTTTCCAGGCAGGTGG + Intergenic
985823070 5:2173761-2173783 CCAGCCGATGTCCTGACATGAGG + Intergenic
988860800 5:35276047-35276069 CCAGTGGATGTCCACAAACGTGG - Intergenic
992015821 5:72574299-72574321 CCAGCGATGGTGCACACAGGTGG - Intergenic
993143873 5:84069909-84069931 CCAGCAGAAGAGCACACAGGTGG + Intronic
993358888 5:86948505-86948527 CCAGGAGATGTCCAGACAGTTGG - Intergenic
999414893 5:151386494-151386516 GCAACAGATGTCCACACAAGTGG - Intergenic
1004178947 6:13364686-13364708 GCAGGGGATGTCCACAGAGAGGG - Exonic
1009817941 6:68760666-68760688 GTAGCAGCTGTCCACACAGGTGG + Intronic
1012127355 6:95447477-95447499 CCAGAGATTGTCCACATAGGTGG - Intergenic
1012440169 6:99255029-99255051 TCAGCGGAGGAACACACAGGTGG + Intergenic
1018950262 6:168374359-168374381 CCAGCGGCCATCCACACAGCCGG + Intergenic
1018984750 6:168627966-168627988 CTGGCTGATGTCCACACAGAAGG - Intronic
1031922237 7:127610930-127610952 CCAGGCAACGTCCACACAGGAGG + Exonic
1034838477 7:154374041-154374063 CCAGCCTATTTTCACACAGGAGG + Intronic
1035724751 8:1817605-1817627 CCAGCGCCTGTCCCCACAGGGGG - Intergenic
1037892681 8:22631765-22631787 GCAGGGAATGTCAACACAGGAGG - Intronic
1041011381 8:53547246-53547268 CCAGCGCTTGTCCACACGTGTGG - Intergenic
1043424439 8:80134668-80134690 CAAGTGGAGGTCCACACAGTAGG + Intronic
1045685817 8:104710797-104710819 CTACTGGATGTCCACACTGGGGG + Intronic
1050614640 9:7389075-7389097 CCAGCTGGTGTCCAAAGAGGAGG + Intergenic
1052690436 9:31809474-31809496 CCAGCGGAAGAACACACAAGCGG - Intergenic
1062413389 9:136435772-136435794 CCAGGGGATGTGGACACAAGGGG + Intronic
1186415375 X:9378921-9378943 ACAGCGGATGTGAATACAGGAGG + Intergenic
1195269380 X:103215291-103215313 CCTGCGGATGCCCACCCCGGGGG + Intronic
1196242033 X:113353268-113353290 TCAGCGGAGGAACACACAGGTGG + Intergenic
1199058628 X:143327792-143327814 TCAGCTGATGCCCACCCAGGAGG + Intergenic
1199267925 X:145849478-145849500 TCAGCGGAGGAACACACAGGCGG - Intergenic
1199765230 X:150936522-150936544 CCAGCTGGTGTCTACACAGATGG - Intergenic