ID: 1145275500

View in Genome Browser
Species Human (GRCh38)
Location 17:21426962-21426984
Sequence TGATTTTTGTCCTTTTTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145275500_1145275501 -8 Left 1145275500 17:21426962-21426984 CCATTTAAAAAGGACAAAAATCA No data
Right 1145275501 17:21426977-21426999 AAAAATCAGAGCCCAGTCCCAGG No data
1145275500_1145275502 -3 Left 1145275500 17:21426962-21426984 CCATTTAAAAAGGACAAAAATCA No data
Right 1145275502 17:21426982-21427004 TCAGAGCCCAGTCCCAGGCCTGG No data
1145275500_1145275503 -2 Left 1145275500 17:21426962-21426984 CCATTTAAAAAGGACAAAAATCA No data
Right 1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145275500 Original CRISPR TGATTTTTGTCCTTTTTAAA TGG (reversed) Intergenic
No off target data available for this crispr