ID: 1145275503

View in Genome Browser
Species Human (GRCh38)
Location 17:21426983-21427005
Sequence CAGAGCCCAGTCCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145275500_1145275503 -2 Left 1145275500 17:21426962-21426984 CCATTTAAAAAGGACAAAAATCA No data
Right 1145275503 17:21426983-21427005 CAGAGCCCAGTCCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145275503 Original CRISPR CAGAGCCCAGTCCCAGGCCT GGG Intergenic
No off target data available for this crispr