ID: 1145276156

View in Genome Browser
Species Human (GRCh38)
Location 17:21432249-21432271
Sequence CAGCAACAGATGAAGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145276156_1145276163 4 Left 1145276156 17:21432249-21432271 CCCCACTCCTTCATCTGTTGCTG No data
Right 1145276163 17:21432276-21432298 CTTGGGTTGTTTACCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145276156 Original CRISPR CAGCAACAGATGAAGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr