ID: 1145276866

View in Genome Browser
Species Human (GRCh38)
Location 17:21436825-21436847
Sequence CTCACTCACCACAGTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145276856_1145276866 23 Left 1145276856 17:21436779-21436801 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG No data
1145276859_1145276866 4 Left 1145276859 17:21436798-21436820 CCATCTCTCAATTCCACATTCTT No data
Right 1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG No data
1145276858_1145276866 13 Left 1145276858 17:21436789-21436811 CCTCATCTTCCATCTCTCAATTC No data
Right 1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG No data
1145276857_1145276866 17 Left 1145276857 17:21436785-21436807 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG No data
1145276860_1145276866 -9 Left 1145276860 17:21436811-21436833 CCACATTCTTCCTCCTCACTCAC No data
Right 1145276866 17:21436825-21436847 CTCACTCACCACAGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145276866 Original CRISPR CTCACTCACCACAGTCATGG GGG Intergenic