ID: 1145282491

View in Genome Browser
Species Human (GRCh38)
Location 17:21478099-21478121
Sequence CAGCCTGGAGAGCTTGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145282480_1145282491 11 Left 1145282480 17:21478065-21478087 CCTTTGCCCAACATAACCCCTGC No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282482_1145282491 4 Left 1145282482 17:21478072-21478094 CCAACATAACCCCTGCTCCTGTT No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282481_1145282491 5 Left 1145282481 17:21478071-21478093 CCCAACATAACCCCTGCTCCTGT No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282479_1145282491 14 Left 1145282479 17:21478062-21478084 CCACCTTTGCCCAACATAACCCC No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282485_1145282491 -7 Left 1145282485 17:21478083-21478105 CCTGCTCCTGTTCCCTCAGCCTG No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282478_1145282491 22 Left 1145282478 17:21478054-21478076 CCTTGCTTCCACCTTTGCCCAAC No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282484_1145282491 -6 Left 1145282484 17:21478082-21478104 CCCTGCTCCTGTTCCCTCAGCCT No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282477_1145282491 23 Left 1145282477 17:21478053-21478075 CCCTTGCTTCCACCTTTGCCCAA No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data
1145282483_1145282491 -5 Left 1145282483 17:21478081-21478103 CCCCTGCTCCTGTTCCCTCAGCC No data
Right 1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145282491 Original CRISPR CAGCCTGGAGAGCTTGCCCA GGG Intergenic
No off target data available for this crispr