ID: 1145285636

View in Genome Browser
Species Human (GRCh38)
Location 17:21504118-21504140
Sequence TGCAGATCCCAGGCTGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145285633_1145285636 -10 Left 1145285633 17:21504105-21504127 CCTGGGCTGTTGCTGCAGATCCC No data
Right 1145285636 17:21504118-21504140 TGCAGATCCCAGGCTGGCTTTGG No data
1145285627_1145285636 21 Left 1145285627 17:21504074-21504096 CCTGCAGGTCTGACTTCTAGTGG No data
Right 1145285636 17:21504118-21504140 TGCAGATCCCAGGCTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145285636 Original CRISPR TGCAGATCCCAGGCTGGCTT TGG Intergenic
No off target data available for this crispr