ID: 1145288566

View in Genome Browser
Species Human (GRCh38)
Location 17:21524250-21524272
Sequence GAGGATTAAATGGCGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145288566_1145288577 -1 Left 1145288566 17:21524250-21524272 CCCTCCGCCGCCATTTAATCCTC No data
Right 1145288577 17:21524272-21524294 CCAGTCATGTGAGGGAGGATGGG No data
1145288566_1145288571 -10 Left 1145288566 17:21524250-21524272 CCCTCCGCCGCCATTTAATCCTC No data
Right 1145288571 17:21524263-21524285 TTTAATCCTCCAGTCATGTGAGG No data
1145288566_1145288573 -6 Left 1145288566 17:21524250-21524272 CCCTCCGCCGCCATTTAATCCTC No data
Right 1145288573 17:21524267-21524289 ATCCTCCAGTCATGTGAGGGAGG No data
1145288566_1145288572 -9 Left 1145288566 17:21524250-21524272 CCCTCCGCCGCCATTTAATCCTC No data
Right 1145288572 17:21524264-21524286 TTAATCCTCCAGTCATGTGAGGG No data
1145288566_1145288575 -2 Left 1145288566 17:21524250-21524272 CCCTCCGCCGCCATTTAATCCTC No data
Right 1145288575 17:21524271-21524293 TCCAGTCATGTGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145288566 Original CRISPR GAGGATTAAATGGCGGCGGA GGG (reversed) Intergenic
No off target data available for this crispr