ID: 1145289824

View in Genome Browser
Species Human (GRCh38)
Location 17:21534332-21534354
Sequence GGGCTCCAGCATCACAGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145289818_1145289824 8 Left 1145289818 17:21534301-21534323 CCTGGGCTGTATGCAAACATCCC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 196
1145289816_1145289824 21 Left 1145289816 17:21534288-21534310 CCACCGAACTGAACCTGGGCTGT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 196
1145289817_1145289824 18 Left 1145289817 17:21534291-21534313 CCGAACTGAACCTGGGCTGTATG 0: 1
1: 0
2: 3
3: 50
4: 180
Right 1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145289824 Original CRISPR GGGCTCCAGCATCACAGTGA AGG Exonic
900307063 1:2015732-2015754 GGGCTCCAGCACCAGATTGTGGG - Intergenic
900713206 1:4128053-4128075 GGGCTCCTCCCTCACAGAGAGGG - Intergenic
902744684 1:18465772-18465794 GGCCTCCAGCACCACAGAGAAGG + Intergenic
902813749 1:18904414-18904436 TGGGTCTAGCATCACAGGGAAGG - Exonic
902916439 1:19642935-19642957 GTGCTCCAGGATCACACTGGAGG + Intronic
902916460 1:19643079-19643101 GTGCTCCAGGATCACACTGGAGG + Intronic
903119773 1:21208067-21208089 GTGGTCCATCATCACAGTAAAGG + Intergenic
903685445 1:25128378-25128400 AGTCTCCGGCCTCACAGTGATGG - Intergenic
903891369 1:26572532-26572554 GGGCTGCATCATCACAGTCCCGG + Intronic
904129638 1:28266193-28266215 GGGCCCCAGCATAACAGCCAGGG - Intronic
907089302 1:51709586-51709608 GGGCTTCAGCATCTCGGTGCAGG + Intronic
908563259 1:65328573-65328595 GGGTTCCTGAATCACAGTCAAGG + Intronic
909528221 1:76651459-76651481 GGCCTCCAGCAACAGACTGAAGG - Intergenic
910207848 1:84765500-84765522 GAGCTCCAGAGCCACAGTGAGGG + Intergenic
912490008 1:110057588-110057610 GGGCTCCAGCATCAGAATCAAGG + Intronic
912498572 1:110106932-110106954 GGTCTCCAGCAGCATAGTGGTGG + Intergenic
917426215 1:174917195-174917217 GGGCTTCAGTATCTCAGTGTGGG + Intronic
920053728 1:203178409-203178431 GCCCTCCAGCCTCCCAGTGAGGG - Intergenic
921578360 1:216864836-216864858 GGGATGCAGGATCACACTGAAGG + Intronic
922975395 1:229779635-229779657 TGGCTCCACCATCTCAGTGTGGG + Intergenic
924749587 1:246873511-246873533 TTTCTCCTGCATCACAGTGAAGG + Intronic
1062916555 10:1244727-1244749 TGTCACCAGCATGACAGTGAGGG + Intronic
1063672718 10:8112383-8112405 GCGCTCCAGGCTCACAGGGAAGG - Intergenic
1065089750 10:22219978-22220000 GGGCACCAGCATCTCTGTGAAGG + Intergenic
1065814696 10:29473165-29473187 GGGCTCCAGCACCTTCGTGATGG - Intronic
1066455048 10:35565365-35565387 GGGCTCCACCTTCACACTGTGGG - Intronic
1069754041 10:70762306-70762328 GTGCCCCAGCATCCCAGGGAGGG - Exonic
1070657967 10:78284207-78284229 GGGTTTTAGCATCACAGTAAGGG + Intergenic
1070823847 10:79379708-79379730 GAGCTTCAGCACCACAGTGGGGG + Intergenic
1071601262 10:86959721-86959743 GGGCTCCTGCATCCTAGTGCTGG + Intronic
1072021495 10:91407975-91407997 GGTCTCCAGAAGCACACTGATGG + Intergenic
1072756905 10:98027517-98027539 GGGTTCCAAGACCACAGTGAGGG + Intronic
1072899676 10:99395917-99395939 GGGCTCCAGCCAGACAGGGAAGG + Intergenic
1073468487 10:103708378-103708400 GGGCTCCAACCTCCCACTGAGGG - Intronic
1078060722 11:8041026-8041048 GGGAACCAGCATCACTGTGTGGG + Intronic
1078387312 11:10903848-10903870 GGGCTTCTACATCACAGTGATGG + Intergenic
1078514205 11:12008864-12008886 GGGCTCCAGCATCACAGGTGAGG - Exonic
1081044031 11:38250031-38250053 GGGCACCTGCATCAGGGTGAAGG + Intergenic
1083717794 11:64588465-64588487 GGGCTCTAGGCACACAGTGAGGG + Intergenic
1083936699 11:65873131-65873153 GGGCTCCAGGATTACGGTGTGGG - Intronic
1084585697 11:70060803-70060825 GGGCTCCAGCAGCACAGCCTTGG + Intergenic
1084946083 11:72639332-72639354 GGGCTGCAGCCACACAGAGAAGG + Intronic
1091041364 11:132284548-132284570 GGGTCCCAGTATCACAGTGTGGG - Intronic
1092056617 12:5512860-5512882 GGGTTACAGCAGGACAGTGACGG - Intronic
1092965777 12:13640635-13640657 ACGTTCAAGCATCACAGTGATGG + Intronic
1094351578 12:29531620-29531642 GGACTCCAGCTTCACAGATAGGG - Intronic
1094694434 12:32803633-32803655 GGTCTCAAGCATTTCAGTGAAGG - Intronic
1095666907 12:44812895-44812917 GGGCTCTATAATCACACTGATGG + Intronic
1096369882 12:51060174-51060196 GGACTGCTGCATCACAGTGGAGG - Exonic
1097171394 12:57115729-57115751 GCACTCCAGCAACAGAGTGAGGG + Intronic
1102287002 12:111665766-111665788 GGGCGCCAGCCTCCCAGTGATGG - Exonic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1105626409 13:22117277-22117299 GGGCTCCAGAAAGACAGGGATGG + Intergenic
1108305409 13:49127124-49127146 GGGTTCCAGTATCCCAGTGGGGG - Intronic
1109683589 13:65784356-65784378 GGGTGTCAGCATCACTGTGAAGG + Intergenic
1112325536 13:98440815-98440837 GGACTTCAGCATCGCAGTGGAGG + Exonic
1112973206 13:105285906-105285928 GAGCTCCAGTAGCAGAGTGAGGG + Intergenic
1113150541 13:107258618-107258640 TGGCTTCTGCATCACCGTGATGG - Intronic
1118169786 14:63377229-63377251 GGGCTCCACCATCTCAGGCATGG + Intronic
1118502058 14:66371115-66371137 GGACTCCTGCTTCACAGTGGAGG + Intergenic
1120015376 14:79467318-79467340 GGGCTTCAGCACCACTGTGAAGG + Exonic
1122535371 14:102458285-102458307 GGGCTCCACCCTGACAGTGGTGG - Intronic
1124340750 15:28887782-28887804 GGGCTCTAGCAGCACTGTCAGGG + Intronic
1124648250 15:31455723-31455745 TGGCTCCACAGTCACAGTGATGG + Intergenic
1125367338 15:38932303-38932325 GTGCACCAGCAAAACAGTGAGGG + Intergenic
1125956761 15:43795711-43795733 GGGCAGCAGAAACACAGTGAGGG + Exonic
1127223753 15:56909042-56909064 GGGCATCAGAATCACAGGGAGGG + Intronic
1129455462 15:75674242-75674264 GGGTTGCAGCAGCAAAGTGAAGG - Intergenic
1130987467 15:88854241-88854263 GAGCCCCAGCATCACAAGGAGGG + Intronic
1131991997 15:98101824-98101846 GGGCTCCAGCTTCTCAGGGCAGG + Intergenic
1132359264 15:101198937-101198959 GGGCTCCAGCATAAAGGTGAAGG - Intronic
1132481253 16:167244-167266 GGGCTGCAGGGTCACAGGGAGGG - Intergenic
1132639706 16:972178-972200 CGGCCCCAGCAACACAGGGAAGG - Intronic
1132750649 16:1455913-1455935 GGGCCCCAGCCACACAGAGAGGG + Intronic
1133237099 16:4392502-4392524 GGGCTCCAACAAGACAGTGGAGG + Intronic
1134055816 16:11169162-11169184 AGGCTCCATAATCACAGAGACGG - Intronic
1134904294 16:17966801-17966823 GGTCACCACCATCACAGTCAAGG - Intergenic
1136469839 16:30472843-30472865 GGATTCCTGCATCACTGTGATGG + Exonic
1137299792 16:47137894-47137916 GGAGTCAAGCATCAGAGTGAAGG + Intronic
1139319744 16:66104787-66104809 GGGCACCAGGATCACAGCCAGGG + Intergenic
1141423856 16:83933220-83933242 GGGCTCCAGGGTCACAGCCAAGG + Intronic
1142233388 16:88910255-88910277 GGGCTGCAGCATCACCGGGAAGG - Intronic
1143038318 17:4014117-4014139 GGGCTACAGATTCACCGTGACGG - Exonic
1143809551 17:9460007-9460029 GAGCTCCAGCATCACACAGGAGG + Intronic
1143987180 17:10924770-10924792 GGGCTCCTGCATCCCAGAGGTGG + Intergenic
1144568873 17:16382398-16382420 GGGCTCCACCTCCAGAGTGATGG - Exonic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1146582115 17:34047774-34047796 GGGCTGCAGTCTCACAGTGGAGG - Intronic
1146902829 17:36599567-36599589 GAACCCCAGCTTCACAGTGATGG - Intronic
1150437452 17:65165058-65165080 GGGCTCCAGGGACACAGAGATGG + Intronic
1152655702 17:81518328-81518350 GGGCACCAGCTTCACTGTGGAGG - Intronic
1152881936 17:82822561-82822583 GGGCTTCAGGAACACAGTGAGGG + Intronic
1153563281 18:6393867-6393889 GGGCTCCATATTCATAGTGACGG - Intronic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1156527239 18:37778519-37778541 GGGCACCAGCAACCAAGTGACGG + Intergenic
1156827226 18:41445623-41445645 GGGAATCATCATCACAGTGATGG + Intergenic
1157881427 18:51324644-51324666 GTGCTCCAGGATCACAGAGCAGG - Intergenic
1159584176 18:70267408-70267430 GGGTTTCAGCTTCACAGTAAAGG - Intergenic
1160345957 18:78131893-78131915 GGGCTCCCGCATCCAACTGATGG + Intergenic
1165086009 19:33347910-33347932 GGTCCCCAGCATCCCAGAGAAGG - Intergenic
1167818557 19:51905655-51905677 GTGCTCCAACCTCACAGTGCAGG - Intronic
1168226325 19:54997807-54997829 GGAGTCCAGCAGCACAATGATGG + Intronic
925079961 2:1056158-1056180 GGGCTCCAGCTTCATTCTGAAGG + Intronic
925389550 2:3486062-3486084 GGGCTCCAGCACCACACACATGG + Intergenic
927189358 2:20506544-20506566 GGATTCCAGGATCACAGTGAGGG + Intergenic
927295489 2:21448172-21448194 GGGCTCCATCATCAGACTGCCGG - Intergenic
927695640 2:25237936-25237958 TGGCTCCAGGATCTCAGTGTGGG + Intronic
927831689 2:26356827-26356849 GAGCTCCAGCATCATAAAGAAGG - Intronic
927938925 2:27091630-27091652 GGGCTCCAGTAACACTGTGAGGG + Intronic
929431050 2:41886872-41886894 GGGCTAAAACATCACAGTGTTGG - Intergenic
931216886 2:60253649-60253671 GGGCTCCAGCATAACAGGGAAGG + Intergenic
935136252 2:100305527-100305549 GGGCACCATCAGCACAGTCATGG - Intronic
935518867 2:104078815-104078837 GGCCTCCAGCACCACAGAGCAGG - Intergenic
935661322 2:105469105-105469127 TGGGTCCTGCATCTCAGTGATGG - Intergenic
937349347 2:121150582-121150604 TGGCTCCTGCTTCACAGGGATGG - Intergenic
941164151 2:162067268-162067290 GGGTTCCAGCCTCACAGAAATGG + Intronic
941281555 2:163558260-163558282 GGGCTCATGCACTACAGTGAAGG - Intergenic
941392828 2:164935859-164935881 GGGCTCCAGTCCCAGAGTGAGGG - Intronic
944230113 2:197384015-197384037 GGGCCACAGTATCACAGTTAAGG + Intergenic
946034734 2:216732583-216732605 GGGCTCCAGGTGCACAGAGAAGG - Intergenic
946792720 2:223317697-223317719 GGGTTGCTGGATCACAGTGATGG + Intergenic
947153381 2:227136525-227136547 AGCCTCCAGCAGTACAGTGATGG + Intronic
947605397 2:231482762-231482784 CGGCTACAGCACCCCAGTGACGG - Intronic
947952822 2:234162679-234162701 GGGCTCCGGCAGCACATTGGTGG - Intergenic
948488079 2:238293975-238293997 GGGCTCCTTCAGGACAGTGAGGG - Intergenic
948666769 2:239539741-239539763 GGTAGCCAGCACCACAGTGAAGG + Intergenic
948842672 2:240662844-240662866 GGCTCCCAGCATCAGAGTGATGG + Intergenic
949028291 2:241776539-241776561 GGGCTCCAACAGCACAGCGACGG - Intergenic
1168881294 20:1208463-1208485 CAGCTCCAGCATCACAGAGCAGG - Intergenic
1169704771 20:8490161-8490183 GTGCTCAAGCCTCACAGTGTTGG - Intronic
1171493543 20:25538619-25538641 TGGCCCCAGGGTCACAGTGATGG + Intronic
1171935579 20:31272261-31272283 GGGCTGCAGCATCATAGTGCTGG + Intergenic
1172169601 20:32920998-32921020 GGGAGTCAGTATCACAGTGAGGG - Intronic
1173361732 20:42350654-42350676 GGGTTTCAGCATCACTGTGATGG + Exonic
1174084216 20:47993857-47993879 TGGCTCCACCATCACAATGTGGG - Intergenic
1174124311 20:48291465-48291487 GATCTCCACCATCACAGTGCAGG - Intergenic
1176362569 21:6010206-6010228 GCCCTCCAGCATCACACCGAAGG - Intergenic
1178920032 21:36732691-36732713 GGTCTCCAGAATGACAGAGATGG - Intronic
1179483749 21:41695414-41695436 GTGCTCCAGCACCACAGTGTAGG + Intergenic
1179760949 21:43528339-43528361 GCCCTCCAGCATCACACCGAAGG + Intergenic
1179975694 21:44864720-44864742 GGGAAGCAGCATCACAGTGCAGG - Intronic
1181061048 22:20282154-20282176 GGGCTGAAGTCTCACAGTGAGGG - Intronic
1182439499 22:30354484-30354506 GATCTCCAGCTTCACAGTGCAGG - Intronic
1184764046 22:46562291-46562313 CTGCTCCAGCATCCCTGTGAGGG + Intergenic
1184807272 22:46803261-46803283 GCCCTCCAGCCCCACAGTGAGGG + Intronic
1185232471 22:49691144-49691166 GGGCTTCAGCATCTCAGTTCGGG - Intergenic
949332691 3:2939808-2939830 GGGCTCCAGCACAACAGTGCAGG - Intronic
950305861 3:11915017-11915039 GGGCTCCAGCTCCACTGTAAAGG + Intergenic
950484420 3:13264605-13264627 GGGCTCTAGCATCACTCTGCAGG + Intergenic
950495492 3:13331619-13331641 GGGCTCCAGGAACACAGATATGG - Intronic
954274336 3:49532614-49532636 GGCCACAAGCATCACTGTGACGG + Exonic
954783158 3:53074965-53074987 GGGCCCCAGCCCCAGAGTGAGGG + Intronic
961398569 3:126616582-126616604 GGGGCCCAGCAGCACAGTGGGGG - Intronic
961465947 3:127081745-127081767 GGGCCCCAGCACTTCAGTGATGG + Intergenic
963361235 3:144274475-144274497 GGACTCCAGCACAACAGTGGTGG + Intergenic
966717737 3:183030402-183030424 GGGCACCAGCAGCGTAGTGAAGG - Intronic
968746188 4:2361855-2361877 GGGCAGCAGCATCACAGTCTTGG + Intronic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
970464533 4:16309434-16309456 GGGCTTGAGCTTCACAGGGAAGG + Intergenic
977047842 4:92090031-92090053 GGTCTCCACCATCACAGTGGTGG - Intergenic
981286612 4:143025818-143025840 AGGATCCAGCAACACAGTGAGGG + Intergenic
984441407 4:179774981-179775003 GGTCTCCACCATCACAATGGTGG + Intergenic
986177478 5:5364491-5364513 GAGCTCCTGCCTAACAGTGAAGG - Intergenic
987458979 5:18183879-18183901 GCTATTCAGCATCACAGTGAAGG + Intergenic
988689852 5:33561237-33561259 TGACTCCAGGATCCCAGTGATGG - Intronic
990778114 5:59326395-59326417 TGGCTCCAGAATCACAGAGAGGG - Intronic
1000046841 5:157528848-157528870 GGGCTCCAAAATTACAGTGCTGG + Intronic
1001882322 5:175254999-175255021 GGGCACCAGCATCAGTGGGAGGG - Intergenic
1002350493 5:178579962-178579984 GGGATCCAGCCTCCCAGAGAGGG - Intronic
1004843667 6:19614763-19614785 GGGCTACAGCAGCACAGAGCTGG + Intergenic
1005955668 6:30661755-30661777 GGACTTCACCATCACAGTTAGGG - Intronic
1009457221 6:63871721-63871743 CAGCTCCAGCATCACAAGGAAGG - Intronic
1009975101 6:70663801-70663823 GGGCTTCAGCATCTCTGTGCAGG - Intergenic
1010273046 6:73936778-73936800 GCTCTCCAGTATCACAGTCAAGG - Intergenic
1010810964 6:80298601-80298623 GGTCTCCATCATCACAATGGTGG - Intronic
1013190458 6:107800685-107800707 GGGCCCCAGTATAACAGAGAGGG - Intronic
1015101376 6:129485802-129485824 GGGCACCTGCCACACAGTGATGG - Intronic
1015939661 6:138434953-138434975 CCTCTCCATCATCACAGTGAAGG - Intronic
1016107985 6:140186621-140186643 GGACTTCAGCATCCCACTGATGG + Intergenic
1018176164 6:161181184-161181206 GGGCCCCAGCAACGCTGTGAAGG + Intronic
1019075295 6:169382367-169382389 GGGCCTCAGCATCAGAATGAGGG + Intergenic
1019536804 7:1533597-1533619 GGGCACCAGGATCAGGGTGAGGG + Intronic
1020538886 7:9436229-9436251 GGGCTCCTAAAACACAGTGAGGG - Intergenic
1021880789 7:25093564-25093586 GGGTTCCAGCATCAGGGTCATGG + Intergenic
1028007493 7:85593474-85593496 GGGCCCCAGCACCACAGACAAGG - Intergenic
1031235412 7:119169148-119169170 GGGCTACAGTAGCACAGTGCTGG - Intergenic
1032796914 7:135285002-135285024 GGGCTCAGGCATCCCAGTGGGGG + Intergenic
1033598461 7:142872449-142872471 CCGCTCCAGCATCACTGTGGTGG + Exonic
1033603737 7:142909567-142909589 CCGCTCCAGCATCACTGTGGTGG + Exonic
1035313774 7:157985640-157985662 AGGCTTCAGGACCACAGTGATGG - Intronic
1035563586 8:627068-627090 GGGCTCCAGCAGGACGGGGATGG + Intronic
1036808125 8:11848976-11848998 GGGCCCCAGCTTCTCAGTGGAGG - Intronic
1038426670 8:27468392-27468414 GGGTTACAGCATCAGAGGGAGGG + Intronic
1041990179 8:63978765-63978787 GGGCTGCAGTTTCACAGTGAAGG + Intergenic
1042177173 8:66048185-66048207 AAGCTCCAGAATCACAGTGTAGG - Intronic
1047228352 8:122975295-122975317 GGGCACCAGCATCACCTGGAAGG + Intergenic
1048329177 8:133460708-133460730 GGGCTCCCGCAGCACAGAGGAGG + Intronic
1048867418 8:138771095-138771117 AGGCCCCAGGATCACAGTGCAGG + Intronic
1049192450 8:141295884-141295906 GGGCTCCAGCACCAAAGCCAGGG - Intronic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1055165302 9:73184821-73184843 GGGCTGCAGCAGCACAATGCTGG + Intergenic
1056451012 9:86716728-86716750 GGGTTCCAGAATCAGACTGATGG + Intergenic
1057862499 9:98652612-98652634 GGGCTCTAGCCTCACTTTGAAGG - Intronic
1057893822 9:98890405-98890427 AGGCTCCTGCAGCACAGTGCAGG + Intergenic
1059652127 9:116324764-116324786 GGGCTCCAGCATCATGGAGGGGG + Intronic
1061546870 9:131309533-131309555 GTCCATCAGCATCACAGTGAGGG - Intergenic
1061748074 9:132754596-132754618 AAGCACCAGCATCACAGAGAGGG - Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1203793554 EBV:164108-164130 GGGCTTCAGCATCAATGTCAAGG - Intergenic
1186618472 X:11214428-11214450 GGGCTCCACCCTCAGGGTGATGG + Intronic
1187205170 X:17175083-17175105 TGGCCCCAGCATGACAGAGAAGG + Intergenic
1189065037 X:37798522-37798544 GGGCTCAATCATCAAAGTGTGGG - Intronic
1189292414 X:39895642-39895664 GGGCTCCACCTTCACCTTGATGG - Intergenic
1190603581 X:52117471-52117493 GGACTCCAGACACACAGTGAAGG + Intergenic
1190920861 X:54851342-54851364 GGTCTCCACCATCACAATGGTGG - Intergenic
1192079336 X:68032399-68032421 GGGCTGCAGCAGCACAATTAAGG + Intergenic
1199671078 X:150148822-150148844 GGGCCACAGCACCACAGTGGTGG - Intergenic
1201617795 Y:15920946-15920968 GTGTTGCAGGATCACAGTGAAGG - Intergenic