ID: 1145297647

View in Genome Browser
Species Human (GRCh38)
Location 17:21604559-21604581
Sequence TAGAAGGGCTGGAGGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145297647_1145297652 -9 Left 1145297647 17:21604559-21604581 CCTAATTCCCTCCAGCCCTTCTA No data
Right 1145297652 17:21604573-21604595 GCCCTTCTATACACTATGGATGG No data
1145297647_1145297655 18 Left 1145297647 17:21604559-21604581 CCTAATTCCCTCCAGCCCTTCTA No data
Right 1145297655 17:21604600-21604622 ACACACTCATACCATCCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145297647 Original CRISPR TAGAAGGGCTGGAGGGAATT AGG (reversed) Intergenic
No off target data available for this crispr