ID: 1145298499

View in Genome Browser
Species Human (GRCh38)
Location 17:21613349-21613371
Sequence CAGTATAACCCCAGATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145298499_1145298512 6 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298512 17:21613378-21613400 GTGGCAGGGGTGGTCGGGGGAGG No data
1145298499_1145298510 2 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298510 17:21613374-21613396 CGTGGTGGCAGGGGTGGTCGGGG No data
1145298499_1145298507 0 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298507 17:21613372-21613394 CCCGTGGTGGCAGGGGTGGTCGG No data
1145298499_1145298505 -4 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298505 17:21613368-21613390 ACTGCCCGTGGTGGCAGGGGTGG No data
1145298499_1145298503 -8 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298503 17:21613364-21613386 TTATACTGCCCGTGGTGGCAGGG No data
1145298499_1145298509 1 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298509 17:21613373-21613395 CCGTGGTGGCAGGGGTGGTCGGG No data
1145298499_1145298511 3 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298511 17:21613375-21613397 GTGGTGGCAGGGGTGGTCGGGGG No data
1145298499_1145298502 -9 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298502 17:21613363-21613385 GTTATACTGCCCGTGGTGGCAGG No data
1145298499_1145298504 -7 Left 1145298499 17:21613349-21613371 CCTGGCTATCTGGGGTTATACTG No data
Right 1145298504 17:21613365-21613387 TATACTGCCCGTGGTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145298499 Original CRISPR CAGTATAACCCCAGATAGCC AGG (reversed) Intergenic
No off target data available for this crispr