ID: 1145298680

View in Genome Browser
Species Human (GRCh38)
Location 17:21614160-21614182
Sequence TCCAGCTGGCCAGGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145298680_1145298691 24 Left 1145298680 17:21614160-21614182 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145298691 17:21614207-21614229 AAGGCACTCGATCCCACCCCAGG No data
1145298680_1145298687 -7 Left 1145298680 17:21614160-21614182 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145298687 17:21614176-21614198 AGCTGGACTTGGCCAGGGGCCGG No data
1145298680_1145298689 5 Left 1145298680 17:21614160-21614182 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1145298689 17:21614188-21614210 CCAGGGGCCGGTTTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145298680 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr