ID: 1145303654

View in Genome Browser
Species Human (GRCh38)
Location 17:21657287-21657309
Sequence GGCCGCCTGAACCTCCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145303643_1145303654 25 Left 1145303643 17:21657239-21657261 CCCCTCCGGCACCAAGGAGGCAT No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data
1145303651_1145303654 -7 Left 1145303651 17:21657271-21657293 CCGCTTGCGACACCGGGGCCGCC No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data
1145303644_1145303654 24 Left 1145303644 17:21657240-21657262 CCCTCCGGCACCAAGGAGGCATC No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data
1145303645_1145303654 23 Left 1145303645 17:21657241-21657263 CCTCCGGCACCAAGGAGGCATCA No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data
1145303646_1145303654 20 Left 1145303646 17:21657244-21657266 CCGGCACCAAGGAGGCATCACTC No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data
1145303647_1145303654 14 Left 1145303647 17:21657250-21657272 CCAAGGAGGCATCACTCACAGCC No data
Right 1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145303654 Original CRISPR GGCCGCCTGAACCTCCGCCA GGG Intergenic
No off target data available for this crispr