ID: 1145311038

View in Genome Browser
Species Human (GRCh38)
Location 17:21701191-21701213
Sequence GCCACTGATGTGCCCACCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145311038_1145311040 -2 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311040 17:21701212-21701234 GCTGAGAGCAGGCTTTGTTCTGG 0: 2
1: 0
2: 1
3: 19
4: 208
1145311038_1145311041 2 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311041 17:21701216-21701238 AGAGCAGGCTTTGTTCTGGCTGG 0: 2
1: 0
2: 1
3: 15
4: 216
1145311038_1145311042 7 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311042 17:21701221-21701243 AGGCTTTGTTCTGGCTGGCATGG 0: 2
1: 0
2: 1
3: 29
4: 232
1145311038_1145311045 23 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311045 17:21701237-21701259 GGCATGGATGCCCTGCTGCGGGG 0: 2
1: 0
2: 2
3: 10
4: 145
1145311038_1145311043 21 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311043 17:21701235-21701257 CTGGCATGGATGCCCTGCTGCGG 0: 2
1: 0
2: 3
3: 23
4: 223
1145311038_1145311044 22 Left 1145311038 17:21701191-21701213 CCGGGGGTGGGCACATCAGTGGC 0: 1
1: 1
2: 0
3: 16
4: 201
Right 1145311044 17:21701236-21701258 TGGCATGGATGCCCTGCTGCGGG 0: 2
1: 0
2: 3
3: 25
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145311038 Original CRISPR GCCACTGATGTGCCCACCCC CGG (reversed) Intronic
900148054 1:1166916-1166938 GCCCCCCAGGTGCCCACCCCAGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900523560 1:3117539-3117561 GCCTATGCTGTCCCCACCCCCGG + Intronic
900585654 1:3431186-3431208 GCCACTCGTGAGCCCATCCCTGG + Intronic
900805445 1:4764431-4764453 GCCTCTGATCTGTCCACCACTGG + Intronic
901022675 1:6262990-6263012 GGCACTGCTGTGGCCAGCCCTGG + Intergenic
901033813 1:6324139-6324161 GTCTCAGATGAGCCCACCCCTGG + Intronic
902258715 1:15207645-15207667 TCCACTCGTGTGCACACCCCTGG - Intronic
902287143 1:15414015-15414037 GCCTCGGGAGTGCCCACCCCTGG + Intronic
902726125 1:18337430-18337452 GTCTCTGATGTGCCCACTCCTGG + Intronic
903605273 1:24570958-24570980 GCCTCTGCTATGCCCACCACTGG + Intronic
904013037 1:27400718-27400740 GCCAGTGTTCTGCCCAGCCCTGG - Intergenic
904494534 1:30879168-30879190 GCCACTGATGGGCCCCCTTCTGG + Intronic
905328043 1:37171860-37171882 GCCACTGCTGAGCTCAGCCCGGG - Intergenic
905656845 1:39691142-39691164 GCAACTGAAGAGCCCACCCCTGG - Intronic
910000114 1:82331192-82331214 GACACTGTCGTGCCCACCCTTGG - Intergenic
918284698 1:183040690-183040712 CCCACCTATGTGCTCACCCCGGG - Intronic
919149717 1:193680352-193680374 GCCCCTGTTGTGCCCAGCCCAGG + Intergenic
919417393 1:197328598-197328620 GCCACTTGTGTGAACACCCCAGG + Exonic
922526463 1:226308548-226308570 CCCACCGGTGTGTCCACCCCTGG - Intronic
924022146 1:239795444-239795466 GACACTGAGGTGCTAACCCCTGG - Intronic
1064985391 10:21204727-21204749 GACAATGCTCTGCCCACCCCAGG - Intergenic
1065879776 10:30028612-30028634 GCCACTGTTTTCCCCATCCCCGG + Exonic
1066262019 10:33738316-33738338 GCCACTAAAGTGCCCATCTCTGG - Intergenic
1070073058 10:73108328-73108350 TCAAATGATGTGCCCACCTCGGG + Intergenic
1071464549 10:85927335-85927357 GCCACTGATCCTCCCACCTCGGG - Intronic
1073323628 10:102630156-102630178 GCCACTGCAGGGCCCAGCCCAGG - Exonic
1074134424 10:110614525-110614547 GCCCCCGATCTCCCCACCCCGGG + Intergenic
1074141033 10:110672644-110672666 GGGACCGCTGTGCCCACCCCAGG - Intronic
1076251347 10:128986194-128986216 GCCACTGATCAGCCCAGCTCAGG - Intergenic
1076450644 10:130554784-130554806 GAGACAGATGTGCCCACCACTGG - Intergenic
1076821843 10:132943401-132943423 TCCCCTAGTGTGCCCACCCCGGG - Intergenic
1077153722 11:1082416-1082438 GCCTCTGCTGTGCCCAGCCCTGG - Intergenic
1077227438 11:1444587-1444609 GCCACGGAGGGGCCCAGCCCAGG + Intronic
1077267654 11:1660012-1660034 GCCACTGAGGTGCCCACAAAGGG + Intergenic
1077848316 11:6049510-6049532 GCCATTGCTGTCCCCACCTCTGG - Intergenic
1078107266 11:8366181-8366203 TCCCCTGATGGGCCCACTCCAGG - Intergenic
1078649495 11:13175091-13175113 GCCATTGATGTGCTTACCCAAGG - Intergenic
1083058078 11:59842401-59842423 GCCTCTGATGTTCCCAGCTCGGG + Intronic
1083287288 11:61668289-61668311 GCCCCTGATGTACTGACCCCAGG - Intergenic
1084518788 11:69650482-69650504 GCCACTGAGGTGCTCGCCCTCGG - Intronic
1085278936 11:75317666-75317688 GCCAGTGCGGTGCACACCCCTGG - Intronic
1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG + Intronic
1087425073 11:97975276-97975298 TCCACTGATGTGGCTACCCTCGG + Intergenic
1089366487 11:117924006-117924028 GCCTGTGATATGCCCAACCCTGG - Intronic
1092365122 12:7871410-7871432 GCCAGTCATCTCCCCACCCCCGG + Intronic
1092380809 12:7995495-7995517 GACACTGTTCTGCCCACGCCTGG - Intergenic
1093489425 12:19688072-19688094 TCCAGTGATCGGCCCACCCCAGG - Intronic
1095825942 12:46530878-46530900 GCACCTGGAGTGCCCACCCCAGG + Intergenic
1101086738 12:101243888-101243910 GTCACTGGTCTGTCCACCCCAGG - Intergenic
1101839543 12:108318120-108318142 GCAACTCAAGTGCCCATCCCTGG - Intronic
1102051039 12:109862129-109862151 GCCTCTGACGTGACCACCCTAGG - Intronic
1102206599 12:111095139-111095161 ACCACAGCTGTTCCCACCCCAGG - Intronic
1102961573 12:117096886-117096908 TCCACTGATTTGCACACCCCTGG + Intronic
1104713923 12:131004533-131004555 GCTAATGCTGTGCCCACTCCAGG + Intronic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1107740203 13:43442423-43442445 ACCTCTGCTGTGCCCACCACTGG + Intronic
1108227146 13:48301810-48301832 GCCTCTGATTTGGCCAGCCCTGG - Intergenic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1113925313 13:113938680-113938702 GCCCTTGCTGTGCCCACCACTGG + Intergenic
1113990601 14:16024616-16024638 GCCACTGACCTGCCCCCACCCGG + Intergenic
1114665880 14:24376813-24376835 GCCGCTGCTGTAGCCACCCCTGG - Exonic
1117264855 14:54076404-54076426 GCCACTTCTGTACCCACCCAGGG - Intergenic
1117423595 14:55572839-55572861 GCTACTGATCTGCCCTCGCCTGG + Intronic
1118763271 14:68893641-68893663 GCCAGTGATGTGGGTACCCCCGG - Exonic
1121256114 14:92531579-92531601 GCGTATCATGTGCCCACCCCAGG - Intronic
1121870742 14:97404576-97404598 GCCGCAGAGGTGCTCACCCCTGG - Intergenic
1122022855 14:98853870-98853892 GTGATTGCTGTGCCCACCCCGGG + Intergenic
1122412069 14:101530716-101530738 GCCACCCATGTGCCCATCCTGGG + Intergenic
1122413877 14:101539347-101539369 CCCAAGGAGGTGCCCACCCCCGG - Intergenic
1124193166 15:27597961-27597983 GCCATTGGTGGGCCCATCCCAGG + Intergenic
1124559494 15:30758563-30758585 CCCACTGATGGTCCCAGCCCCGG - Intronic
1124671756 15:31647155-31647177 CCCACTGATGGTCCCAGCCCCGG + Intronic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1128312798 15:66641957-66641979 ACCACTGGTTTGCCCACACCAGG - Intronic
1129454654 15:75670267-75670289 GCCACTGCTGTGCCCATGCTGGG - Intergenic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1130154595 15:81338690-81338712 GCTACTGATGTGTCCAACCACGG + Exonic
1130484009 15:84387448-84387470 CGCACTGATGTCCCCTCCCCTGG + Intergenic
1131175416 15:90206242-90206264 GCCTCTGATGTGGCCCTCCCTGG + Intronic
1131254711 15:90854486-90854508 CTCACTGATCTACCCACCCCGGG + Intergenic
1132419676 15:101654468-101654490 GCCACTGATGGGTCCACTCATGG - Exonic
1137063302 16:35811501-35811523 GCCTGTGATGTTCACACCCCAGG + Intergenic
1139447203 16:67005171-67005193 GTCACTGGTGGGCCCACCTCTGG + Intronic
1139523247 16:67497369-67497391 GACACTTATGTGGACACCCCAGG + Intergenic
1141882809 16:86871097-86871119 GCCATGGCTGTGCCCACCCAGGG + Intergenic
1144029080 17:11303894-11303916 TCCACTGCTGTACCCACCTCAGG - Intronic
1145272829 17:21413728-21413750 GCCACTGACGTGCCCACCCCCGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1146630208 17:34464115-34464137 GCCAGTGTTGTGCCCCCCACAGG - Intergenic
1147969649 17:44212549-44212571 GACACTGATGTGACCTCCCATGG - Intronic
1148790510 17:50170167-50170189 GCAGATGAGGTGCCCACCCCAGG + Exonic
1150503650 17:65676100-65676122 TCAAGTGATCTGCCCACCCCTGG - Intronic
1154306485 18:13234307-13234329 GCGACTAATGTGCGCACCCAGGG - Intronic
1158414956 18:57242117-57242139 ACCACTGCCCTGCCCACCCCAGG - Intergenic
1160983554 19:1827449-1827471 GCCACTCCTGTGGCCACCTCAGG - Exonic
1162454722 19:10776433-10776455 GCCACAGCTGTGCCCTCCCTGGG - Intronic
1162505105 19:11079040-11079062 GCAACGGATCTGCCCACCACTGG + Intergenic
1164907843 19:31981994-31982016 ACCACCCATGTGCCAACCCCTGG - Intergenic
1165090978 19:33388332-33388354 GCCACCCATGTGCACACACCCGG + Intronic
1165471042 19:36004735-36004757 CCCACTGGTTTACCCACCCCAGG - Intronic
1166269339 19:41704348-41704370 GACACTGGTGTTCCCACTCCTGG - Intronic
1167508122 19:49881857-49881879 CCGAGTCATGTGCCCACCCCTGG + Intronic
1167558982 19:50214109-50214131 GCCACTGCTGTGCCCAGCTGGGG + Intronic
1168094775 19:54108207-54108229 GGCACGGATGCCCCCACCCCAGG - Exonic
925903660 2:8526216-8526238 GCAGCTGCTGTGACCACCCCAGG + Intergenic
926065047 2:9831905-9831927 GGCTCTGATGAGACCACCCCAGG - Intergenic
926694608 2:15762597-15762619 TCCACTGGTGTGCCCAGCCTTGG + Intergenic
927469046 2:23358559-23358581 ACCACTGAAGTGCCCACTGCTGG - Intergenic
927631470 2:24777733-24777755 GCCACCGCTGCGCCCAGCCCAGG + Intergenic
932813873 2:74845975-74845997 GGCACAGGTGTGCCCACCCTGGG - Intronic
934862965 2:97779731-97779753 GCCACTGCTGCGCCCAGCCCTGG - Intronic
937345789 2:121124530-121124552 CCCACTGGGGTGCCCATCCCAGG - Intergenic
941553346 2:166943661-166943683 GCCAATCATATGCCCACCACTGG - Intronic
942787677 2:179719164-179719186 TCCACCCATGAGCCCACCCCAGG + Intronic
944330852 2:198464790-198464812 TCAACTGATCTGCCCACCTCAGG - Intronic
945484192 2:210375540-210375562 TCAAGTGATGTGCCCACCTCCGG + Intergenic
946165935 2:217863860-217863882 GCAGCTGCTGTGCCCACCCCAGG - Intronic
948068814 2:235103237-235103259 ACCACTGACCTGCCAACCCCAGG + Intergenic
948854925 2:240725602-240725624 GCCACAGCTCTGTCCACCCCTGG + Intronic
949041056 2:241850156-241850178 GCCCCCCATGTGCCCACCCTGGG - Exonic
1168957494 20:1844625-1844647 ACCAGGGATGTGCCCACCTCAGG - Intergenic
1170141506 20:13129234-13129256 TCAAGTGATTTGCCCACCCCAGG + Intronic
1171244768 20:23602541-23602563 GCCACTGATATGTCAACTCCTGG + Exonic
1172102889 20:32496178-32496200 CCCACTGCTGTTCCTACCCCAGG + Intronic
1174253411 20:49236184-49236206 GCCACTGATGTGGCAGCCCGTGG + Exonic
1174450571 20:50617565-50617587 GCCACCGCTGTGCCCAGCCAAGG + Intronic
1174588721 20:51628335-51628357 GCCTCTGATGTGGCCCCTCCTGG + Intronic
1175072716 20:56347787-56347809 GCCACTGCTGCGGCCTCCCCTGG + Intergenic
1175604769 20:60303675-60303697 CACACTTTTGTGCCCACCCCGGG + Intergenic
1175662818 20:60831460-60831482 GCTACTGATGAGCCCACCAAGGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176368077 21:6045600-6045622 GCCACTGAGGGGCCCAGCCAAGG - Intergenic
1178341200 21:31786739-31786761 GCCACAGATTTGCACACCCTGGG - Intergenic
1179755442 21:43492942-43492964 GCCACTGAGGGGCCCAGCCAAGG + Intergenic
1180316669 22:11282910-11282932 GCCACTGACCTGCCCCCACCCGG - Intergenic
1181166630 22:20987482-20987504 ACCACCCCTGTGCCCACCCCAGG + Exonic
1181877022 22:25947690-25947712 ACCACTGATCTGCCTCCCCCAGG + Exonic
1182107162 22:27697848-27697870 GGCACTGTTCTGCCCACCCCTGG - Intergenic
1182779505 22:32856410-32856432 GTCACTGATCTACCCACCCCAGG - Intronic
1183706248 22:39476427-39476449 GCTTCTGCTGTGCCCACCCATGG - Intronic
1184159855 22:42691782-42691804 GACACTGAGGAGCCCACCGCCGG - Intergenic
1185130354 22:49035362-49035384 GACCCTGATCTGGCCACCCCAGG - Intergenic
950223278 3:11212917-11212939 ACCATAGATGTGCCCACCCCAGG + Intronic
951807371 3:26661105-26661127 GTCACTGATGTACATACCCCTGG - Intronic
953901916 3:46848419-46848441 GCCACTGATGTCCAAGCCCCAGG + Intergenic
953917242 3:46927878-46927900 CCCACTTAACTGCCCACCCCCGG + Intronic
954414343 3:50385676-50385698 GCCACCCATCTGCCCACCCCTGG + Intronic
954663575 3:52238834-52238856 CCCCCAGATGTGCCCACCCCAGG + Intronic
960946644 3:122971404-122971426 GGCACTAATGTGCCCACTCATGG + Intronic
961219114 3:125186021-125186043 GGCACTGGTGTGAACACCCCTGG - Intronic
961374098 3:126450933-126450955 AGCACTGTTGTGGCCACCCCGGG - Intronic
961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG + Intronic
968554977 4:1242271-1242293 GTCACTGAGCTGCCCACACCTGG + Intronic
968807742 4:2786622-2786644 ACCCCTGATGTGCCCAGCCCAGG - Intergenic
969845265 4:9915468-9915490 TCAAGTGATCTGCCCACCCCAGG + Intronic
969846732 4:9925378-9925400 ACACCTGCTGTGCCCACCCCTGG + Intronic
969871761 4:10109087-10109109 TCCACTGAGGGGCCCACCCAGGG - Intronic
975482151 4:74892637-74892659 GTCAGTGAGGTGACCACCCCAGG + Intergenic
976334089 4:83865509-83865531 GACCCTGATGTGAGCACCCCTGG + Intergenic
977581733 4:98732479-98732501 GCCTGTCATTTGCCCACCCCTGG - Intergenic
977699787 4:100008151-100008173 GCAACTGATGTACACACCCTTGG + Intergenic
985538298 5:476399-476421 GTCACAGCTGTGCCCACCGCCGG + Intronic
990236291 5:53771602-53771624 GGCTCTGATGTGAACACCCCAGG + Intergenic
993062019 5:83050016-83050038 ACCTCTGCAGTGCCCACCCCAGG - Intergenic
993330278 5:86591140-86591162 GCCACTGATTTACCTAGCCCAGG - Intergenic
993457689 5:88144284-88144306 GCCTCTGAGGTGCCCCACCCCGG + Intergenic
1003276518 6:4658616-4658638 GCCAGTGGTGTTCCCACCTCAGG - Intergenic
1004591264 6:17054196-17054218 GCCACTGAGCTGACCACACCTGG + Intergenic
1005977934 6:30814423-30814445 CCCAGTCATGTGGCCACCCCTGG - Intergenic
1006440390 6:34050154-34050176 GCCAGGCATGAGCCCACCCCAGG + Intronic
1010202992 6:73299298-73299320 GCGGCTGCTGTGCCCACCCCCGG - Intronic
1013102333 6:106997528-106997550 GCCTCAGATGTGGCCACCCTGGG + Intergenic
1016437972 6:144057437-144057459 GCCACTGATGGGCCAGCCCTTGG - Intronic
1017685718 6:156912429-156912451 TCCACTTTTGTGCCCACTCCAGG + Intronic
1018932478 6:168250364-168250386 GCCACTGCTGAAACCACCCCAGG + Intergenic
1019219083 6:170460813-170460835 GCCTCTGATGTGCAGGCCCCCGG - Intergenic
1019316166 7:387931-387953 CCCTCTGATGTGGCCACCCTGGG - Intergenic
1019598496 7:1869434-1869456 GCCATCGCTGTGCCCAACCCTGG - Intronic
1022112248 7:27239047-27239069 GCCACTGCTGGGTGCACCCCTGG - Intergenic
1025854241 7:65264263-65264285 GACATTCATGTGCCCAGCCCTGG - Intergenic
1029626686 7:101724367-101724389 GACCCTGATGTGCTCACCTCAGG + Intergenic
1031750361 7:125563890-125563912 GCCACTGAGCAGCCAACCCCAGG + Intergenic
1033048005 7:137979906-137979928 GAAACTGATGTGGCCTCCCCTGG - Intronic
1034147214 7:148884059-148884081 GCCACTGCTGTGCCGGTCCCGGG - Intronic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1034830406 7:154303596-154303618 ACCACTGCTATACCCACCCCTGG + Intronic
1036017454 8:4800799-4800821 ACCACTCAGGTGCCCTCCCCAGG - Intronic
1036716363 8:11127813-11127835 GCCATTAATGTGTCTACCCCAGG + Intronic
1037884698 8:22589833-22589855 GCCTGTGAGGTGCTCACCCCAGG + Intronic
1038856596 8:31339841-31339863 GCCACTGATGTAACCACTCAGGG + Intergenic
1040478103 8:47798623-47798645 GCCCCTTATGTTCCCAGCCCAGG - Intronic
1040484236 8:47854993-47855015 GCCTCTGATGTCCCCACGCTGGG - Intronic
1046899582 8:119509588-119509610 GCCATTGATGGGACCACCCTGGG + Intergenic
1048682931 8:136866327-136866349 GCTAATGAGGTGACCACCCCAGG + Intergenic
1049494295 8:142922503-142922525 GCCACTGATCTGTCCTCCCAAGG - Intergenic
1049536942 8:143186781-143186803 GGCACTGAAGGGCCCACCCAGGG + Intergenic
1051511788 9:17886726-17886748 GTCACTGCTTTACCCACCCCAGG + Intergenic
1055770132 9:79708166-79708188 CGAACTGATGCGCCCACCCCAGG + Exonic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1057829430 9:98395548-98395570 GTCTCTGCTCTGCCCACCCCAGG - Intronic
1058877650 9:109258544-109258566 TCCACTGTTGTTCCCACCCAGGG + Intronic
1058978877 9:110150664-110150686 GCCATTGTTCTGCCCACCACAGG + Intronic
1059422253 9:114199521-114199543 GCTTCTGCTGTGCCCTCCCCAGG + Intronic
1060405582 9:123371415-123371437 GCCTCGGAAGGGCCCACCCCAGG - Exonic
1061196109 9:129108152-129108174 GGCACTTAAGTGCCCATCCCTGG + Intronic
1061261621 9:129483414-129483436 GCCGCTGACGTGCCCAGCCCTGG - Intergenic
1061522306 9:131125981-131126003 GCCACTATTGTGACCGCCCCAGG - Intronic
1062407170 9:136402364-136402386 GCCTCTGAGATGGCCACCCCGGG - Exonic
1062524681 9:136973416-136973438 CCCACCTCTGTGCCCACCCCCGG - Intergenic
1190176914 X:48158024-48158046 GCCACTGCTCTGCCCCCTCCAGG - Intergenic
1197853405 X:130889144-130889166 GCCCCAGGTGTGGCCACCCCAGG - Intronic
1198190352 X:134298790-134298812 GCCACTCATCCCCCCACCCCTGG + Intergenic
1198377657 X:136055132-136055154 TCCACTGATTTGCCCAATCCAGG - Intergenic
1199199981 X:145075825-145075847 GCCACTGTTGTAGCAACCCCAGG + Intergenic
1199591242 X:149470024-149470046 GCCCCTGGTGTGATCACCCCAGG - Intergenic
1200094571 X:153651167-153651189 CCCACTGATGCACCCAGCCCAGG + Exonic
1202374068 Y:24217848-24217870 CGCACTGATGTCCCCTCCCCTGG - Intergenic
1202496713 Y:25452272-25452294 CGCACTGATGTCCCCTCCCCTGG + Intergenic