ID: 1145311128

View in Genome Browser
Species Human (GRCh38)
Location 17:21701591-21701613
Sequence CAGGCCGCATTCTAGGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 2, 1: 0, 2: 5, 3: 51, 4: 310}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145311117_1145311128 16 Left 1145311117 17:21701552-21701574 CCAGCTTGGGGTGTTCAAAGTGG 0: 2
1: 0
2: 0
3: 3
4: 99
Right 1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG 0: 2
1: 0
2: 5
3: 51
4: 310
1145311116_1145311128 17 Left 1145311116 17:21701551-21701573 CCCAGCTTGGGGTGTTCAAAGTG 0: 2
1: 0
2: 0
3: 8
4: 120
Right 1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG 0: 2
1: 0
2: 5
3: 51
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145311128 Original CRISPR CAGGCCGCATTCTAGGCCCT GGG Intronic
901282987 1:8053709-8053731 CAGGCACCGTTCTAGGCCCTGGG - Intergenic
901740909 1:11341171-11341193 CAGACCGCATCCCAGGCTCTGGG + Intergenic
902393584 1:16120076-16120098 AAGGCCCCATCCCAGGCCCTGGG + Intergenic
902528835 1:17077372-17077394 CAGGCACTATTCTAGGCTCTGGG - Intronic
902664925 1:17930788-17930810 GAGGCCTCATTCCAGGCCCAGGG + Intergenic
902704894 1:18197809-18197831 CAGGCATCATTCTAAGCCCTTGG - Intronic
903422185 1:23225897-23225919 CAGGCCTCCTTCTAGGTCCGGGG - Intergenic
903670686 1:25033854-25033876 AATGCCTCATTCTAGGCCCTTGG + Intergenic
903927725 1:26842799-26842821 CAGGCACGATTCTAGGCACTTGG - Intronic
904561563 1:31401552-31401574 CAGGCACAATTCTAGGCCCTGGG - Intergenic
905998129 1:42399851-42399873 CAGGCAGCATGCTAGGCACTGGG + Intronic
906201410 1:43962890-43962912 CTGGCCTCATTCTGGGCACTGGG - Intronic
907112041 1:51935347-51935369 CAGGCCCCATTCTGGGCACTGGG + Intronic
907264684 1:53250416-53250438 CAGGCACTGTTCTAGGCCCTGGG - Intronic
907329998 1:53664574-53664596 CAGGCACCATTCTAGGCCCTGGG + Intronic
907745971 1:57213904-57213926 CAAGCCCCATGCTAGGCACTGGG + Intronic
908264329 1:62363323-62363345 CAGGCACTATTCTAGGCCCTGGG - Intergenic
909430911 1:75586803-75586825 CAGGCACCGTGCTAGGCCCTTGG - Intronic
910134796 1:83955269-83955291 CAGGCACTATTCTAGGACCTGGG - Intronic
911551190 1:99283091-99283113 CAAGCCTCGTTCTAGGTCCTGGG - Intronic
911878312 1:103198424-103198446 CAGACCGTATTCTAAGCTCTGGG + Intergenic
913197902 1:116473329-116473351 CAGGCCCTTTGCTAGGCCCTGGG + Intergenic
914899718 1:151705262-151705284 CAGGCAGCTTTCTAGGCATTTGG - Intronic
916487545 1:165272831-165272853 CAGGCTGCATTCTAGGCTGAGGG - Intronic
917688069 1:177438304-177438326 CAGGCCCCATGCTAGGCACTTGG - Intergenic
917904095 1:179572511-179572533 CAGGCACTATTCTAAGCCCTGGG - Intronic
919107190 1:193168334-193168356 TAGGCAGTATTGTAGGCCCTGGG + Intronic
919121610 1:193347948-193347970 CAGGCACTGTTCTAGGCCCTAGG - Intergenic
919466135 1:197922864-197922886 CAGGCACCATACCAGGCCCTGGG - Intronic
919668975 1:200321416-200321438 TAGGCAGCGTTCTAGGCTCTGGG + Intergenic
920432620 1:205928432-205928454 CAGGCACCATGCTGGGCCCTGGG - Intronic
920651513 1:207840737-207840759 CAGGCACCATTCTAGGTACTGGG - Intergenic
921056210 1:211544533-211544555 CAGGCATTCTTCTAGGCCCTGGG + Intergenic
921929442 1:220743071-220743093 AAGCCCCCATTCCAGGCCCTAGG - Intergenic
922068453 1:222167336-222167358 CAGGCCCCATTTTGGGCACTGGG - Intergenic
923307563 1:232702149-232702171 CAGGCCCTGTTCTAGGCACTGGG - Intergenic
923546110 1:234924472-234924494 CAGGCCTCGTGCTAGGCACTAGG + Intergenic
923695064 1:236240694-236240716 CAGGCACCATTCTAGGCACTAGG + Intronic
924268391 1:242306048-242306070 AAGGCTGGACTCTAGGCCCTGGG + Intronic
924502682 1:244652297-244652319 CAGGCAGTGTTGTAGGCCCTCGG - Intergenic
1066716511 10:38292681-38292703 AAGGCTGGACTCTAGGCCCTGGG - Intergenic
1068673803 10:59749717-59749739 CAGGCAGCATGCTGGGCTCTTGG - Intergenic
1068808043 10:61222698-61222720 CAGGACTTATTCTAAGCCCTAGG - Intergenic
1068867386 10:61909061-61909083 CAGATCCTATTCTAGGCCCTGGG + Intronic
1069081903 10:64097407-64097429 CAGGCTGCAATCTGGGTCCTTGG + Intergenic
1069894444 10:71671976-71671998 CAGGCCCTATACTAGGCCCTGGG + Intronic
1070918599 10:80170216-80170238 CAGGCCCAGTTCTAGGCACTGGG - Intronic
1071369248 10:84934516-84934538 CAGGCACTATTCTAGGCTCTGGG + Intergenic
1071495595 10:86165539-86165561 CAGGCCGCCTCTTTGGCCCTGGG - Intronic
1072421400 10:95292657-95292679 CAGGCACTATTCTAGGCACTGGG - Intergenic
1072579621 10:96729385-96729407 CAGGCCCCATTCCATGTCCTGGG - Intergenic
1072791408 10:98320948-98320970 CAGGCTCCAGGCTAGGCCCTGGG + Intergenic
1073496486 10:103896215-103896237 CCAGCCCCGTTCTAGGCCCTGGG + Intronic
1073634876 10:105187468-105187490 CAGGCCACATTCTTGGCTATTGG - Intronic
1075474016 10:122717725-122717747 CAGGCCCCATTCTAGGCACGAGG - Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1077646259 11:3928031-3928053 CAGGCACAAATCTAGGCCCTGGG - Intronic
1078249969 11:9608833-9608855 CAGGCACCATTCTGGGCACTGGG + Intergenic
1078510313 11:11979906-11979928 CAGCCTGCCTTCCAGGCCCTGGG + Intronic
1078548664 11:12264837-12264859 TAGGCCTTATTCTAAGCCCTAGG + Intergenic
1080165131 11:29226596-29226618 CAGGCAGTATTCTAAGCCCTGGG - Intergenic
1081544558 11:44060998-44061020 AAGGCCGAGTTCAAGGCCCTGGG + Intergenic
1082050443 11:47766880-47766902 CAGGCCGAGTTCTGCGCCCTCGG - Intronic
1082756005 11:57077287-57077309 CAGGCCCTGTTCTAGGCACTTGG + Intergenic
1083029715 11:59581107-59581129 CAGGCAGTATGCTAGGTCCTGGG - Intronic
1084873714 11:72115329-72115351 CAGACACCTTTCTAGGCCCTGGG + Intronic
1085399602 11:76227790-76227812 CAGGCAGTATTCTAGGAGCTGGG - Intergenic
1085550075 11:77361048-77361070 CAGACTCCATTCTAGGCTCTGGG + Intronic
1085626565 11:78078418-78078440 CAGACAGCTTTCTAGGCCCGTGG - Intronic
1085746466 11:79119094-79119116 CAGACATCATTCTAGGTCCTGGG + Intronic
1087773781 11:102239318-102239340 CAGGGACTATTCTAGGCCCTGGG + Intergenic
1087809839 11:102598722-102598744 CAGGCAGCATGCTAAGCCCAAGG - Intronic
1089751836 11:120657176-120657198 CAGGCACTGTTCTAGGCCCTGGG + Intronic
1090441204 11:126727101-126727123 CAGGCTCCATGCTAGGCACTGGG - Intronic
1090821031 11:130341840-130341862 CAGGCAGTGTACTAGGCCCTGGG - Intergenic
1093470840 12:19500740-19500762 CAGGCAAAATTCTAGGCACTTGG - Intronic
1093993914 12:25621130-25621152 CAGGCACTGTTCTAGGCCCTTGG - Intronic
1095989581 12:48025520-48025542 AAGGCCTCATTCACGGCCCTAGG + Intergenic
1096516485 12:52158575-52158597 CCAGGCACATTCTAGGCCCTGGG - Intergenic
1096875421 12:54626412-54626434 CAGGCACTATTCTAGGCACTGGG + Intergenic
1098200570 12:68050960-68050982 CAGGCTCTAATCTAGGCCCTAGG + Intergenic
1099159516 12:79223629-79223651 CAGGCAGCATTAGTGGCCCTTGG - Intronic
1101587859 12:106100612-106100634 CAGGCCCTATTCTAGGCACTAGG - Intronic
1101816267 12:108148353-108148375 CAGGCCCCTTTCTAGGTACTGGG - Intronic
1101840894 12:108326805-108326827 CAGGGTGCATGCGAGGCCCTTGG - Intronic
1103221982 12:119253722-119253744 CAGGCACTATTCTAGGCACTGGG - Intergenic
1104054792 12:125221234-125221256 CAGGCAGCATTCTAGGTCCTGGG - Intronic
1104939318 12:132387460-132387482 AAGGCCCCATTGCAGGCCCTGGG - Intergenic
1106110379 13:26771807-26771829 CAGGCAGTGTTCTAGGGCCTTGG - Intergenic
1106310855 13:28552995-28553017 CAGGCACTATTCTAGGCCTTGGG + Intergenic
1107006826 13:35621260-35621282 CAGGCAGTGTTCTAGGCCCTGGG - Intronic
1108622990 13:52202098-52202120 CAGGCACAATTCTAGGCTCTTGG - Intergenic
1108668982 13:52662543-52662565 CAGGCAGTGTTCTAGGCACTGGG - Intronic
1109220207 13:59633881-59633903 CAGGCAAAATTCTAGGCCCCAGG - Intergenic
1110241418 13:73271320-73271342 CAGGCCTCTGTCAAGGCCCTGGG - Intergenic
1112203200 13:97298420-97298442 CAGCCTGCATTCTAGGTGCTTGG - Intronic
1112253507 13:97806281-97806303 CAGGCACCATTCTAGGCACTGGG + Intergenic
1114208288 14:20593911-20593933 CAGGCACTCTTCTAGGCCCTTGG + Intronic
1114552768 14:23543184-23543206 CAGGCACCGTGCTAGGCCCTCGG + Intronic
1115195785 14:30797924-30797946 CAGGCCCTGTTCTAGGCACTGGG + Intergenic
1117545771 14:56794257-56794279 CAGCCGGCCTCCTAGGCCCTAGG + Intergenic
1117766875 14:59092745-59092767 CAGGCTCCATTCTAGGCACTGGG - Intergenic
1118867701 14:69716356-69716378 CAGGCGCCCTTCTAGGCTCTTGG + Intergenic
1120816868 14:88869918-88869940 CAGACTCCATTCTAGACCCTGGG - Intronic
1120887929 14:89466524-89466546 CAGGGCCCATTCTAGGCATTTGG + Intronic
1120924009 14:89780125-89780147 CAGGCCCCATGCCAGGCACTGGG - Intergenic
1122134796 14:99626664-99626686 GAGGCAGTATTCTAGGTCCTGGG + Intergenic
1122862448 14:104588650-104588672 CCGGCCGCAGTATAGGCCCAGGG - Exonic
1127321062 15:57846966-57846988 CAGGCACCATGCTAGGCACTGGG - Intergenic
1127567085 15:60201340-60201362 CAGGCCCCTTTCAAGCCCCTGGG + Intergenic
1128291634 15:66482666-66482688 CAGGCCCCATGCCAGGCACTAGG - Intronic
1128352378 15:66899776-66899798 CAAGCACCATTCTAGACCCTGGG - Intergenic
1128871236 15:71156816-71156838 CAGGCTGTATTCTAGGAGCTGGG - Intronic
1129169276 15:73798009-73798031 CAGGCCCCATTCTGGGCCCTGGG + Intergenic
1129237013 15:74229810-74229832 CAGGCAACATGCTGGGCCCTGGG + Intergenic
1129711784 15:77824094-77824116 CAGGCCAGATTCCAGGGCCTTGG + Intergenic
1130533032 15:84762137-84762159 CAGGCACTATTCTAGGCACTGGG + Intronic
1130996131 15:88905362-88905384 CAGACACCATTCTAGGCCCTGGG + Intronic
1131388567 15:92028476-92028498 CAGCCAGTGTTCTAGGCCCTGGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131526254 15:93155073-93155095 CAGGCCACATTCGAGGGGCTGGG + Intergenic
1131586018 15:93693515-93693537 CAGGCAGTATTCTAGGCACATGG + Intergenic
1133247315 16:4457710-4457732 CAGGCCCTATTCTAGTTCCTGGG + Intergenic
1133857808 16:9565994-9566016 CAGGCGCCATTCTAGGCACTGGG - Intergenic
1134904641 16:17969843-17969865 CAGGTACCATGCTAGGCCCTGGG + Intergenic
1135075819 16:19392761-19392783 CAGGCACCATCCTAGGCACTGGG + Intergenic
1136012613 16:27373786-27373808 CAGGCACTGTTCTAGGCCCTGGG - Intergenic
1136055236 16:27683455-27683477 CAGGCCTCTTTCCAGGCTCTGGG - Intronic
1136503892 16:30690137-30690159 CAGGCATTATTCTAGGCACTGGG - Intergenic
1136532080 16:30876514-30876536 CAGGCACCACACTAGGCCCTAGG + Intronic
1137496695 16:48974873-48974895 CAGGCATTGTTCTAGGCCCTGGG - Intergenic
1138089142 16:54159869-54159891 CTAGCGGCATTCTAGGCACTTGG - Intergenic
1138475996 16:57270937-57270959 CAGGCGCTATTCTATGCCCTGGG + Intronic
1139434949 16:66931267-66931289 CAGGCCGGACTCTAGCTCCTGGG - Intergenic
1139666574 16:68461179-68461201 CAGGCACCATTCTAGGCACTGGG - Intergenic
1141076615 16:81011438-81011460 CAGGCCCTTTTCTAGGCACTGGG - Intronic
1141247073 16:82317912-82317934 CAGGCTACATTCCAGGCACTGGG - Intergenic
1141648370 16:85379340-85379362 CAGGCACCATTCTAGGCACTGGG - Intergenic
1142684235 17:1568433-1568455 CAGGCACGATTCTAGGCACTGGG + Intergenic
1143648709 17:8249181-8249203 CCGGCCGAATTCTAGGTTCTTGG - Intronic
1144548454 17:16218367-16218389 TAGGCCTTATTCTATGCCCTAGG + Intronic
1145272925 17:21414155-21414177 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145325658 17:21821911-21821933 CAGGCACCATGCTAGGCCCTGGG - Intergenic
1146645467 17:34574175-34574197 CAGGCACCATTCTGGGCACTGGG + Exonic
1147252717 17:39162996-39163018 CAGGCCCCGTGCTGGGCCCTGGG + Intronic
1148615245 17:48996417-48996439 CTGGCAGCTCTCTAGGCCCTAGG - Intergenic
1148615539 17:48997579-48997601 CAGGCCGCCTTCCCCGCCCTGGG + Exonic
1148752879 17:49955621-49955643 CAGGCCTCATTCAAGTCCCTCGG - Intergenic
1149836894 17:59921210-59921232 CAGGCCTCATTCTGGGGCCCAGG + Intronic
1150091393 17:62328981-62329003 CAGGCACTGTTCTAGGCCCTTGG + Intergenic
1150301350 17:64049623-64049645 CAGGCACCATTCTGGGCCCTGGG - Intronic
1150850647 17:68700773-68700795 CAGGCCTCATTCTAGGAGCTGGG - Intergenic
1151269689 17:72984595-72984617 CAGGCCCCATTCCAGGCCTCTGG + Intronic
1153192485 18:2557346-2557368 CAGGCACTATTCTTGGCCCTAGG - Intronic
1153226256 18:2902298-2902320 CAGGCCTTGTGCTAGGCCCTGGG + Intronic
1155511294 18:26580147-26580169 CAAGCCCCATTCCAGGCTCTTGG + Intronic
1157728230 18:49981642-49981664 CAGGCAGTGTTCAAGGCCCTGGG - Intronic
1157842226 18:50968778-50968800 CATGCACCATTCTAGGCACTAGG - Intronic
1161206645 19:3044773-3044795 CAGGCATGATTCTAGGCCCCAGG + Intronic
1161242320 19:3229269-3229291 CAGGCCCTGTTCTAGACCCTGGG + Intronic
1162342099 19:10097426-10097448 CAGCCCCCTTTCTAGGCACTGGG + Intronic
1162850927 19:13430650-13430672 CAGGCTGTGTTCTAGGCTCTGGG + Intronic
1163687330 19:18719274-18719296 CAGGCCGCATTCTGGGCTAGCGG - Intronic
1164810975 19:31155562-31155584 CAGGCAGGCTTCTAGGGCCTCGG + Intergenic
1165799798 19:38542129-38542151 CATGCAGTATTCTAGGCTCTGGG - Intronic
1166133067 19:40758347-40758369 CAGGCGCCATTCAAGGCTCTGGG - Intronic
1166534538 19:43564137-43564159 CAGGCAGTATTCCAGGCACTTGG - Intronic
1167150092 19:47703388-47703410 CAGGCCCCGTTCTAGGCTCAGGG + Intergenic
1168143855 19:54408268-54408290 CAGGCATTGTTCTAGGCCCTGGG - Intergenic
1168449028 19:56448669-56448691 AAGGCCTCATTCTAGGCCATAGG + Intronic
925262743 2:2542551-2542573 CAGGCCGCCTCCTGGGCACTTGG - Intergenic
925362662 2:3290222-3290244 CCGGCAGCATTCTAGGCCTGGGG - Intronic
925465805 2:4106551-4106573 CAGGAAGCATTCTAGGGGCTGGG + Intergenic
925874996 2:8303890-8303912 CAGGCCCTGTGCTAGGCCCTGGG - Intergenic
925893891 2:8457001-8457023 CAGCCAGCATTCTAGGGCCCTGG - Intergenic
927787477 2:25983304-25983326 CAGGCCCCATTCTAGGATCTGGG + Intergenic
927843696 2:26460776-26460798 CAGGCTGCGTGCTGGGCCCTTGG + Intronic
927884116 2:26707984-26708006 CAGGCCCCATTCTAGGCCCCAGG + Intronic
929408692 2:41672115-41672137 CAGGTCCCATTCTAGGCACTGGG + Intergenic
929488559 2:42376326-42376348 CAGGCAGCACTCGGGGCCCTAGG - Intronic
929904476 2:46034144-46034166 CAGACCGCAGTCTTGGCTCTTGG - Intronic
929999469 2:46851066-46851088 CAGGCAGGATTCTAGAACCTTGG + Intronic
930059167 2:47274086-47274108 CAGGCTGTATTCTAGGTGCTGGG - Intergenic
931092845 2:58904820-58904842 CAGGCACTCTTCTAGGCCCTGGG - Intergenic
931738109 2:65216607-65216629 CAGGCTCCATTCTAGGACCTGGG - Intergenic
932144728 2:69307198-69307220 CAGGCACTTTTCTAGGCCCTGGG - Intergenic
936156649 2:110051320-110051342 CAGGCACCATGCTAGGCACTGGG - Intergenic
936188043 2:110320124-110320146 CAGGCACCATGCTAGGCACTGGG + Intergenic
936287756 2:111194258-111194280 CAGGCACCATTCTAGGCACTAGG + Intergenic
936919163 2:117670118-117670140 CAGGCACCATGCTAGGCACTGGG + Intergenic
937314459 2:120922133-120922155 CAGGCACTGTTCTAGGCCCTGGG - Intronic
941343632 2:164339171-164339193 CAGGCCCTATTCCAGGGCCTGGG + Intergenic
942281997 2:174375035-174375057 CAGGCCTTGTTCTAGGCTCTAGG - Intronic
943957605 2:194212717-194212739 CAGGCACCATTCTCGGCTCTGGG + Intergenic
945210190 2:207374936-207374958 GAGGCCCCTTTCCAGGCCCTAGG + Intergenic
945855367 2:215062959-215062981 CAGGCACCATTCTAGGCACTGGG - Intronic
946628076 2:221636391-221636413 CAGGTGGCATTCTTGGCCCTTGG - Intergenic
948815579 2:240508689-240508711 CAGGCACCATTCTAGGCACTAGG - Intronic
948889083 2:240898081-240898103 CAGGCCCCATCCTTGCCCCTTGG + Intergenic
1169482043 20:5991753-5991775 CAGGCATGATTCTGGGCCCTGGG - Intronic
1170070152 20:12357842-12357864 CAGGCAGCTCTCTAGGCACTTGG + Intergenic
1172114089 20:32563371-32563393 CAGGCCCTATTCTAGGCACATGG + Intronic
1174165926 20:48583603-48583625 CCAGCCACATTCAAGGCCCTGGG + Intergenic
1174292827 20:49521047-49521069 CAGGCCCCATTCTAGAAGCTGGG - Intronic
1174430737 20:50466799-50466821 CAGGCAGTGTTCTAGGCACTGGG - Intergenic
1175066923 20:56296887-56296909 CAGGCCCTCTCCTAGGCCCTGGG - Intergenic
1175226004 20:57444442-57444464 CATGCAGCATTGTAGGCACTGGG + Intergenic
1175343098 20:58247478-58247500 CAGGCTGCCTTCCAGTCCCTCGG - Intergenic
1175353901 20:58346739-58346761 CAGGCACCATGCTAGGCCCTGGG - Intronic
1175694354 20:61090259-61090281 CAGGCAGGATTCTAGGCACCTGG - Intergenic
1178491709 21:33056747-33056769 CAGGCAGAGTCCTAGGCCCTGGG + Intergenic
1178600569 21:33990961-33990983 CAGGCAGGGTTCTAGGCACTGGG + Intergenic
1178958708 21:37044850-37044872 CAGGTACCATTCTAGGCCTTAGG + Intergenic
1181510640 22:23387243-23387265 CAGGCCACAGCCCAGGCCCTGGG + Intergenic
1181565558 22:23734999-23735021 CAGGCTGGATTCTAGGCACTGGG + Intergenic
1181859341 22:25806069-25806091 CAGGCCCTGTGCTAGGCCCTGGG - Intronic
1181871695 22:25904248-25904270 CTGGCCTCATTCTAGGCTCTAGG - Intronic
1181951424 22:26556672-26556694 CAGGCTGCATTCGGGGGCCTAGG - Intronic
1182744862 22:32597748-32597770 CAGGCCGTGTTCTAGGAGCTGGG - Intronic
1183263175 22:36809312-36809334 CAGGCCCTATTCTAGGTGCTGGG + Intronic
1183271214 22:36863655-36863677 CAGGCCCTGTCCTAGGCCCTGGG - Intronic
1183344166 22:37297909-37297931 CAGGCACCATCCTAAGCCCTGGG + Intronic
1183671079 22:39273226-39273248 CAGGCCTTGTTCTAGGCACTGGG - Intergenic
1183992281 22:41605656-41605678 CAGGCCTTATGCTAGGCACTGGG + Intronic
1184283662 22:43453710-43453732 CAGGCAGAATTGTAGGCTCTTGG - Intronic
949441739 3:4088683-4088705 CAGGCTCCATCCTAGGCGCTGGG - Intronic
949875766 3:8625155-8625177 CAGGCACTATTCTTGGCCCTGGG - Intronic
950591087 3:13936014-13936036 CAGGCTGCATTGGATGCCCTGGG + Intergenic
950646090 3:14377708-14377730 CAGGCACCATGCTAGGCCTTGGG - Intergenic
950651788 3:14411806-14411828 CAGGCCCTGTCCTAGGCCCTGGG + Intronic
951000373 3:17552543-17552565 CTGGCACTATTCTAGGCCCTAGG + Intronic
952933454 3:38377131-38377153 CAGGGTGCATTCTAGATCCTGGG + Intronic
954595474 3:51820353-51820375 CAAGCCCCATTCTAGGTCCTGGG - Intronic
955386785 3:58487049-58487071 CTGGCCACATTTTAGGTCCTGGG - Intergenic
955659007 3:61276797-61276819 TAGGCACCATTCTAGGCTCTAGG + Intergenic
957116878 3:76037618-76037640 CAAGCCTTATTCTAGGCACTGGG + Intronic
961436144 3:126918389-126918411 CAGACACCATGCTAGGCCCTGGG + Intronic
963063829 3:141246677-141246699 CAGGCAGTGTTCTTGGCCCTGGG + Intronic
963184382 3:142396886-142396908 TTGGCTGCATTCTAAGCCCTGGG + Intronic
963262297 3:143205243-143205265 CAGGCATCATTCTTGGCACTGGG + Intergenic
963849931 3:150201077-150201099 CAGGCAGTAGTCTAGGCACTGGG - Intergenic
964376787 3:156055773-156055795 CAGGCACCATTCTAGGTACTGGG - Intronic
965426847 3:168535586-168535608 CAGGCAGTATTCTAGGCACTAGG - Intergenic
965611475 3:170548397-170548419 CAGGCCCCATTCTAGACCTAAGG - Intronic
965659889 3:171029938-171029960 CAGGCAGCATTTTAGGCACTGGG - Intergenic
965847564 3:172982045-172982067 CAGGCACCATTCTAGGCACAGGG - Intronic
967896116 3:194397267-194397289 CAGGGCGCCTTCCAGGGCCTTGG - Exonic
968645940 4:1740540-1740562 CAGGCCTCACCCTAGGCTCTAGG + Intronic
970196782 4:13559068-13559090 CCAGGCCCATTCTAGGCCCTAGG - Intergenic
970657778 4:18250709-18250731 CAGACCACATTCTAGGCCTGGGG - Intergenic
970994353 4:22248485-22248507 CAGGCTCCATTCTAGGCACTTGG - Intergenic
971395150 4:26220453-26220475 CAGGCATCATTGTAGGCACTTGG + Intronic
974079428 4:57196871-57196893 GAGGCCCCATTCTAGGCATTGGG + Intergenic
977318735 4:95483957-95483979 CAGGCACCATTCTAGGCATTAGG + Intronic
977727933 4:100319485-100319507 CAGACACCATTCTAGGCCCTGGG + Intergenic
977792395 4:101123218-101123240 CAGGCACTATCCTAGGCCCTAGG - Intronic
978524609 4:109652886-109652908 CAGGCGCCATTCTAGGTGCTGGG + Intronic
979917941 4:126461624-126461646 CAGGCAGTATTCTAGTCACTAGG + Intergenic
981360450 4:143839854-143839876 CAGTGCGAATTCTAGGCCCAGGG - Intergenic
982144635 4:152371761-152371783 CAGGCCCAGTTCTAGGCACTTGG - Intronic
982464588 4:155714384-155714406 CAGGCATCATTGTAGGCACTGGG + Intronic
984227338 4:177050941-177050963 CAGCCTGCATTCTAGGAACTGGG + Intergenic
984619535 4:181936854-181936876 AAGGCCCCATGCTAGGCTCTAGG + Intergenic
984651514 4:182275500-182275522 CAAGCAGTGTTCTAGGCCCTGGG + Intronic
986338515 5:6771925-6771947 CAGGCCCCACTCTGGGCACTTGG + Intergenic
987711722 5:21509305-21509327 CAGGTAGCATTCTAGGCTTTGGG - Intergenic
988302692 5:29451517-29451539 CAGGTAGCATTCTAGGCTTTGGG + Intergenic
988560880 5:32279961-32279983 CAGTCCGCAGTCTAGGGGCTGGG + Intronic
988878253 5:35472058-35472080 CAGGCTGCCTGCTAGGCACTGGG + Intergenic
989332970 5:40281393-40281415 CATGCCCTATCCTAGGCCCTGGG - Intergenic
990836521 5:60027668-60027690 CAGACACCATTCCAGGCCCTGGG - Intronic
991600490 5:68347461-68347483 CAGGCCATATTTTATGCCCTGGG + Intergenic
991762088 5:69928431-69928453 CAGGTAGCATTCTAGGCTTTGGG - Intergenic
991841316 5:70803480-70803502 CAGGTAGCATTCTAGGCTTTGGG - Intergenic
992460417 5:76954452-76954474 CTGGGCGCTTTCGAGGCCCTAGG + Intronic
992491449 5:77248247-77248269 CAGCCAGCATTCTTGGCCCTTGG - Intronic
992533068 5:77671018-77671040 CAGGCACCATGCTAGGCTCTGGG - Intergenic
992781320 5:80130824-80130846 CAGGCATCATTCTAGACACTGGG + Intronic
992783829 5:80151756-80151778 CAGGCCCGATTCTAAGCACTGGG + Intronic
994169994 5:96648920-96648942 CAGACAGTATTCCAGGCCCTGGG - Intronic
994428967 5:99631039-99631061 CAGACAGTATTCTAGGCTCTAGG + Intergenic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
997337561 5:133118872-133118894 CAGGCCTCATTCTAGCCCTTAGG + Intergenic
997719961 5:136070384-136070406 CAGGCCCTATGCTAGGCACTGGG - Intergenic
999429322 5:151512331-151512353 CAGGCAGCCTTCAAAGCCCTGGG + Exonic
1000018583 5:157299995-157300017 CAGGCACCATTCTAGGTCCCGGG - Intronic
1001060648 5:168486090-168486112 CAGACAGTATTCTAGGCTCTGGG - Intergenic
1001683356 5:173575186-173575208 AAGGCCCCTTTCCAGGCCCTGGG + Intergenic
1001804301 5:174570383-174570405 CAGGCCCCATTCTAGATGCTGGG - Intergenic
1002160032 5:177309616-177309638 TAGGCCCTATTCTAGGCACTGGG - Intronic
1002896637 6:1383613-1383635 CAGGCCGCATCCGGGGCCCGGGG + Intergenic
1004003992 6:11622511-11622533 CAGGCCCCGGGCTAGGCCCTGGG + Intergenic
1004888238 6:20072263-20072285 CAGGCTCCATTCTAGGGGCTGGG + Intergenic
1005755147 6:28919409-28919431 CAGGCACTATTCTAGGCACTGGG - Intronic
1005930544 6:30481080-30481102 CAGGCGCTATTCTAGGCGCTTGG - Intergenic
1006443536 6:34066569-34066591 CAGGCAGTGTTCTAGGCACTGGG - Intronic
1006935274 6:37712907-37712929 CAGGCAGCACTCCTGGCCCTGGG - Intergenic
1007072325 6:39046867-39046889 CAGACACCATTCTAGGTCCTGGG - Intergenic
1007632853 6:43282534-43282556 CAGAGACCATTCTAGGCCCTGGG + Intronic
1007864910 6:44957712-44957734 CAGGCAGTATTCTAGGTGCTAGG - Intronic
1007998034 6:46329478-46329500 CAGGCATCCTTCTAGCCCCTGGG - Intronic
1011280210 6:85669954-85669976 GAGGCCACAATCTGGGCCCTAGG + Intergenic
1012070464 6:94607248-94607270 CAGGCAGCTTTCTAAGCCTTGGG + Intergenic
1013370719 6:109468695-109468717 CAGGCCAGATTCTCGGCACTGGG - Intronic
1014866845 6:126542851-126542873 CAGGCACTATTCTAGGCTCTTGG - Intergenic
1018641757 6:165910088-165910110 CAGGCACTATTCTAGGCACTGGG - Intronic
1019889791 7:3937253-3937275 CAGGCATTGTTCTAGGCCCTGGG + Intronic
1019994217 7:4713276-4713298 CAGGCCCCAAGCTAGGCTCTGGG + Intronic
1022057608 7:26755666-26755688 CAGGCACTAATCTAGGCCCTAGG - Intronic
1023901702 7:44486236-44486258 CTGTCCGCATTCTAGCCCTTTGG - Intronic
1024082802 7:45869164-45869186 CTGGCCTCATTCTAAGGCCTTGG - Intergenic
1024948892 7:54838344-54838366 CAAGCAACATTCTGGGCCCTGGG + Intergenic
1025244077 7:57303012-57303034 CAGGCAGTGTTCTAGGCACTGGG + Intergenic
1026994308 7:74605917-74605939 CAGGCCTCATTCTGGGCCCTGGG - Intergenic
1029800224 7:102939116-102939138 CAGGCTGCTTTCTAGAACCTAGG + Intronic
1030929598 7:115505690-115505712 CAGGCTGTTTTCTAGGACCTAGG - Intergenic
1031103047 7:117506040-117506062 CAGGCCCTATTCTAGGCACTTGG - Intronic
1033377355 7:140774936-140774958 CAGGTCCCATTCTAGGCATTAGG + Intronic
1034414612 7:150957981-150958003 CTTGCTGCATTCTGGGCCCTCGG - Intronic
1040101868 8:43513003-43513025 CAGGCCTCATCCTGAGCCCTAGG + Intergenic
1041331418 8:56729530-56729552 CAGGCACCATTCTAGGCACTGGG - Intergenic
1042276141 8:67007236-67007258 CAGGCACTGTTCTAGGCCCTTGG - Intronic
1043757903 8:84027362-84027384 CAAGCATCATTCTAGGCACTAGG + Intergenic
1044868733 8:96597811-96597833 CAGGCACCATTCTAGGTTCTAGG + Intronic
1045259792 8:100562347-100562369 CAGGCCCCTTCCAAGGCCCTGGG - Intergenic
1045340923 8:101253751-101253773 CAGGCTCTATTCTAGGCGCTGGG - Intergenic
1045413696 8:101945250-101945272 CAGGCATCATGCTAGGCTCTGGG + Intronic
1048308440 8:133299675-133299697 CAGGCACCATTCTAGACCCTGGG + Intronic
1048645482 8:136414741-136414763 CAGCCCGCATCCCAGGCACTGGG - Intergenic
1049104252 8:140601483-140601505 CAGGCATGATTCTAAGCCCTGGG - Intronic
1050609042 9:7332031-7332053 CAGGCACTATTCTAGGCCCTGGG - Intergenic
1051763801 9:20499852-20499874 CAGGCTGGATTCAAAGCCCTAGG - Intronic
1052028196 9:23598382-23598404 CAGGCACCATTCTAGGTACTGGG + Intergenic
1052806716 9:33019953-33019975 GCGGCCGCATTCCTGGCCCTTGG + Intronic
1052877129 9:33575573-33575595 CAGGCCTCATCCTGGGCCCTGGG + Intergenic
1053203107 9:36166027-36166049 CAAGCCCCACTCTAGACCCTCGG - Intergenic
1054829005 9:69602724-69602746 CAGGCACCACTTTAGGCCCTGGG + Intronic
1057218192 9:93241108-93241130 CAGGCAGCAGTGTTGGCCCTGGG - Intronic
1057275645 9:93674802-93674824 CAGGCCTTAGTGTAGGCCCTGGG + Intronic
1057678324 9:97153312-97153334 CAAGCCTCATCCTGGGCCCTGGG - Intergenic
1057868463 9:98700189-98700211 CTGGCCCTATTCTAGGCTCTGGG - Intronic
1057878056 9:98772639-98772661 GGGGCCTCATTCTGGGCCCTGGG - Intronic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1059329476 9:113525783-113525805 CATGCCCCAGGCTAGGCCCTGGG - Intronic
1059996087 9:119911234-119911256 CAGGCACTATTCTAGGCACTTGG + Intergenic
1060509010 9:124218724-124218746 GAGGCAGCACTCTAGGCCCCAGG + Intergenic
1061397248 9:130349781-130349803 CAGCCCTCAGTCTGGGCCCTGGG - Intronic
1061448950 9:130658586-130658608 CAGGTCCCATACAAGGCCCTGGG - Intergenic
1061499651 9:130994494-130994516 CAGCCCACACTCTGGGCCCTGGG - Intergenic
1062218588 9:135402474-135402496 CAGTCCACATGCTAGGCTCTGGG - Intergenic
1062257921 9:135638656-135638678 CAGGCTGTATTCTAGGTGCTGGG - Intronic
1062721064 9:138044366-138044388 CAGACAGCACTCTAGGTCCTGGG + Intronic
1187254787 X:17632556-17632578 CAGGCACCGTTCTAGGCACTTGG + Intronic
1188424432 X:30029928-30029950 CAGGCCCTGTTCTAGGCACTGGG - Intergenic
1191797311 X:65034912-65034934 CAGGCCTGATTCCAGTCCCTGGG - Intergenic
1192345211 X:70297632-70297654 CAGGCCCAATTCTAGGCACTTGG + Intronic
1192591266 X:72361682-72361704 TAAGCATCATTCTAGGCCCTGGG + Intronic
1193425441 X:81336805-81336827 GAGGCTGCATTGTAGGCCCAAGG + Intergenic
1194286607 X:92019164-92019186 CAGGACTCATTCTTGGCCCCCGG + Intronic
1196433092 X:115648565-115648587 CAGGTCACACTCTAGGCCTTTGG - Intronic
1196607683 X:117674502-117674524 CAGGACTCATTCTTGACCCTTGG + Intergenic
1197642024 X:128977493-128977515 CAAGCCACATTCTATGCCCTGGG - Intergenic
1199366664 X:146994046-146994068 CAGGCACCATTCTTGGCACTGGG + Intergenic
1200049593 X:153421724-153421746 GTGGCCGCAATCGAGGCCCTGGG - Intergenic
1200058425 X:153473368-153473390 CTGACAGCATTCTAGGGCCTAGG - Intronic
1200697857 Y:6376887-6376909 CAGGCCTGATTGTGGGCCCTGGG - Intergenic
1201036255 Y:9787812-9787834 CAGGCCTGATTGTGGGCCCTGGG + Intergenic