ID: 1145311361

View in Genome Browser
Species Human (GRCh38)
Location 17:21702724-21702746
Sequence GTTCCAGGAGCCGCCCTGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145311358_1145311361 -3 Left 1145311358 17:21702704-21702726 CCAGACATGCTGTCCTCTCTGTT 0: 1
1: 1
2: 1
3: 35
4: 288
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244
1145311353_1145311361 16 Left 1145311353 17:21702685-21702707 CCTGGAGCCACCAGCCCAGCCAG 0: 2
1: 1
2: 12
3: 85
4: 692
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244
1145311355_1145311361 6 Left 1145311355 17:21702695-21702717 CCAGCCCAGCCAGACATGCTGTC 0: 2
1: 0
2: 0
3: 36
4: 397
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244
1145311354_1145311361 9 Left 1145311354 17:21702692-21702714 CCACCAGCCCAGCCAGACATGCT 0: 2
1: 0
2: 6
3: 68
4: 420
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244
1145311357_1145311361 1 Left 1145311357 17:21702700-21702722 CCAGCCAGACATGCTGTCCTCTC 0: 1
1: 1
2: 2
3: 31
4: 244
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244
1145311356_1145311361 2 Left 1145311356 17:21702699-21702721 CCCAGCCAGACATGCTGTCCTCT 0: 1
1: 1
2: 1
3: 23
4: 211
Right 1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG 0: 1
1: 1
2: 1
3: 26
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145311361 Original CRISPR GTTCCAGGAGCCGCCCTGCC TGG Exonic
900497924 1:2984775-2984797 GTTCCTGCAACCGCCCTTCCGGG + Intergenic
900712359 1:4122458-4122480 GTGCCTGGAGCAGCCCTGGCCGG + Intergenic
900761876 1:4478060-4478082 CCCCCAGGAGCCACCCTGCCTGG - Intergenic
900941535 1:5801711-5801733 GATCCAGGAGCCTCCCTGAAGGG - Intergenic
901423578 1:9166790-9166812 CTTCCAGGATCCGCCTTCCCAGG - Intergenic
902783980 1:18721283-18721305 GTTCCAGATGCCACCCTGACAGG + Intronic
903604857 1:24568077-24568099 GTTCCAGGCCCAGCCCTGCCTGG - Intronic
904237691 1:29124944-29124966 GGTCCCGGAGCCGCACGGCCAGG + Intergenic
904388648 1:30164335-30164357 GCTCCAGGAGCCCCCCTACAGGG - Intergenic
906688686 1:47778706-47778728 GGTCCTGGTGCCACCCTGCCTGG + Intronic
907053123 1:51343063-51343085 CTTCCAGGACCTTCCCTGCCTGG - Intronic
907365740 1:53958188-53958210 TTTCCGGGAGCTGACCTGCCTGG + Exonic
915899583 1:159836751-159836773 GTTCCCAGATCCTCCCTGCCTGG + Exonic
917765560 1:178212773-178212795 GAGCCATGAGCCGCCGTGCCCGG + Intronic
918031645 1:180819225-180819247 ATTACAGGAGCCACCATGCCTGG + Intronic
919919508 1:202159916-202159938 GGTCCAGGAGCCCGCCTGCCTGG - Intronic
920851107 1:209628248-209628270 ATTCCAGGAGCCAGGCTGCCTGG + Intronic
921133460 1:212239373-212239395 GTTCCCAGAGCCGCCCTCCCTGG - Intergenic
922234479 1:223712775-223712797 CTTCCAGGACCCGTCCTTCCCGG + Exonic
922642313 1:227246160-227246182 GTTCCATGAGCAGTTCTGCCAGG - Intronic
1063362227 10:5468151-5468173 ATTCCAGGAGCCAGCCTTCCAGG + Intergenic
1065328594 10:24571171-24571193 GTTCCAGCAGTCCTCCTGCCTGG - Intergenic
1067851192 10:49755684-49755706 AATCCAGAAGCCACCCTGCCAGG + Intronic
1070589781 10:77793677-77793699 GCTCCAGTCCCCGCCCTGCCTGG + Intronic
1072470094 10:95705829-95705851 GTGCCATGAGCCACCATGCCTGG - Intergenic
1072741896 10:97914752-97914774 GTGCCGGGAGCTGCCCTGCCTGG - Intronic
1073059129 10:100723051-100723073 GTTCCAGGAGCTGTGGTGCCTGG + Intergenic
1073480636 10:103784213-103784235 TTTCCAGGTCCCGCCCTCCCTGG + Intronic
1075085557 10:119412301-119412323 GTGCCAGGCACAGCCCTGCCAGG - Intronic
1075783856 10:125034891-125034913 CTTCCAGCAGCCTCCTTGCCTGG - Intronic
1077362594 11:2147311-2147333 CTCCCAGGAGCTCCCCTGCCAGG + Intronic
1077374037 11:2197358-2197380 GGCCGAGGAGCCGCCCTGCAGGG + Intergenic
1077481768 11:2818352-2818374 GTTCCTGGAGCCACCGTCCCAGG + Intronic
1077680762 11:4237928-4237950 CACCCAGCAGCCGCCCTGCCTGG + Intergenic
1078771811 11:14358740-14358762 GTACCTGGAGCGGGCCTGCCCGG - Intronic
1079092442 11:17490588-17490610 ATTCCTGGAGCAGCCCTGCCTGG + Intergenic
1079104037 11:17559112-17559134 CTTGCAAGGGCCGCCCTGCCTGG - Exonic
1079111309 11:17606625-17606647 GATCCAGGGCCTGCCCTGCCAGG + Intronic
1081596120 11:44460780-44460802 GTTCCAGCACCCTCCCTGCCAGG - Intergenic
1082238811 11:49851709-49851731 GCTCCTGGAGCGCCCCTGCCAGG + Intergenic
1083325005 11:61868832-61868854 TTCCCAGGATCAGCCCTGCCAGG - Intergenic
1083378331 11:62244132-62244154 TTTCCAGGGGCCTCTCTGCCTGG + Intronic
1083610173 11:64000635-64000657 CCTCCCGGAGCCGCCCTGCCTGG - Intronic
1084199117 11:67543558-67543580 ATTCCTGCAGCTGCCCTGCCCGG - Intergenic
1084357677 11:68650897-68650919 GTTCTGGGAGCCGCTCTGCAGGG - Intergenic
1084674239 11:70624828-70624850 TTTCGCAGAGCCGCCCTGCCAGG - Intronic
1084904599 11:72335937-72335959 GTCCCAGAAGCCTCTCTGCCTGG + Intronic
1086690762 11:89787063-89787085 GCTCCTGGAGCGCCCCTGCCGGG + Intergenic
1086697760 11:89864442-89864464 GCTCCTGGAGCGCCCCTGCCAGG - Intergenic
1086708402 11:89980046-89980068 GCTCCTGGAGCGCCCCTGCCAGG + Intergenic
1086715038 11:90052596-90052618 GCTCCTGGAGCGCCCCTGCCGGG - Intergenic
1089461826 11:118658336-118658358 TTTCCTGGAGCCCCACTGCCTGG - Exonic
1089788168 11:120923008-120923030 GATCCAGGAGACACCCTGCACGG + Intronic
1090399121 11:126436995-126437017 CTTCCAGGACCAGGCCTGCCCGG + Exonic
1091002038 11:131917833-131917855 CTTCCAGGAGCCTCCCTCCTTGG - Intronic
1091321847 11:134657373-134657395 CTCCCAGGACCCGCCCAGCCCGG + Intergenic
1093915870 12:24801926-24801948 GTGGCAGGAGCCACCATGCCTGG + Intergenic
1094697232 12:32832103-32832125 ATTACAGGAGCCACCCCGCCTGG - Intronic
1095703848 12:45216878-45216900 CTTCCCGGGGCCGCCCCGCCAGG - Intronic
1096197476 12:49657905-49657927 GTCTTAAGAGCCGCCCTGCCTGG - Intronic
1096329526 12:50698335-50698357 GTTCCAGGAGCCCCTTTGCCAGG + Exonic
1097065472 12:56317290-56317312 GTTCCAGGAGCTTCTCTGCCTGG + Exonic
1097923969 12:65107479-65107501 GTTACAGGAGCTACCATGCCTGG - Intronic
1102238830 12:111310948-111310970 GCTCCAGGCGCTGCCCTGGCAGG + Intronic
1103271916 12:119680477-119680499 GCTGCAGGAGCTGCTCTGCCTGG - Exonic
1104049458 12:125186180-125186202 GCTCCCGGAGCCTCCCGGCCGGG + Intergenic
1104735899 12:131135925-131135947 GGTGCAGGCACCGCCCTGCCGGG - Intronic
1104846091 12:131847708-131847730 GAGCCCCGAGCCGCCCTGCCTGG + Intronic
1105247395 13:18665926-18665948 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1108198687 13:48020739-48020761 TTTTCAGGAGCCGCCCTGGGCGG - Intergenic
1108269811 13:48748641-48748663 GCTCCAGGCTCAGCCCTGCCTGG - Intergenic
1109282882 13:60377539-60377561 GTTCTGGGAGCCACCATGCCCGG - Intergenic
1110619694 13:77581541-77581563 TTTCCAGGAGCCCCCCTGGCAGG - Intronic
1110706764 13:78607065-78607087 GTGCCAGGATCCGCACTGTCTGG + Intergenic
1114046473 14:18880631-18880653 GTGCCCGCAGCCGCCCTTCCCGG - Intergenic
1114117739 14:19638819-19638841 GTGCCCGCAGCCGCCCTTCCCGG + Intergenic
1119955299 14:78791718-78791740 ATTCCAGAAGTCACCCTGCCTGG - Intronic
1121255975 14:92530782-92530804 GTTCCAGCAGCATCCCTTCCAGG - Intronic
1122028100 14:98892336-98892358 GTTCCCAGAGTCCCCCTGCCAGG + Intergenic
1122366204 14:101196177-101196199 GATGCAGGCGCAGCCCTGCCAGG - Intergenic
1122688660 14:103521606-103521628 GCGCCAGGACCCGCCCTCCCTGG + Intronic
1122775940 14:104117006-104117028 GGCCCGGGAGCCGCCCCGCCCGG + Intergenic
1202872664 14_GL000225v1_random:178001-178023 GTCCCTGGAGCCCCCCTGACGGG + Intergenic
1123708463 15:22967760-22967782 ATTACAGGAGCCACCATGCCCGG - Intronic
1124376659 15:29133034-29133056 GGTCCATCTGCCGCCCTGCCCGG + Intronic
1124400225 15:29341579-29341601 GTTCCAGGTGCCGCGCAGACAGG + Intronic
1124847895 15:33309932-33309954 GTTACAGGAGGCTCCCTTCCAGG - Intergenic
1127588221 15:60397842-60397864 GTTGCCGGGGCCTCCCTGCCAGG + Intronic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1128117827 15:65122728-65122750 ATTACAGGAGCCACCCTGCCCGG - Intronic
1128258843 15:66217773-66217795 GTTCTAGAAGCAGCTCTGCCAGG - Intronic
1129393805 15:75233681-75233703 GGTCCAGGTGGGGCCCTGCCTGG + Intergenic
1130554056 15:84910397-84910419 GCTGCGGGAGCCTCCCTGCCTGG - Intronic
1132289039 15:100686473-100686495 TGTCCAGCAGCAGCCCTGCCGGG - Intergenic
1132383112 15:101380313-101380335 CATTCAGGAGCCGCCCTGACGGG + Intronic
1132585686 16:705066-705088 GGTCCAGAAGCCGCCCGCCCGGG + Intronic
1133175508 16:4011173-4011195 GTTCTAGTAACCCCCCTGCCTGG - Intronic
1137249690 16:46732558-46732580 GCTCCAGCAGCTGCCCAGCCAGG - Exonic
1137256729 16:46781323-46781345 GTTCCAGCAACCCCACTGCCTGG + Intronic
1137924523 16:52527623-52527645 GATCCAGGAGCCTCCTTCCCTGG + Intronic
1138342549 16:56299800-56299822 GTTCCACAAGCCACTCTGCCTGG + Intronic
1138496583 16:57412697-57412719 AGTCCAGGTGCTGCCCTGCCTGG + Intronic
1139286329 16:65817710-65817732 GATCCAAGAGCCTCCCTGCTTGG + Intergenic
1140985609 16:80155732-80155754 GTGCTAGGAGCCACCATGCCCGG - Intergenic
1141432104 16:83975570-83975592 GTCACAGGAGCCACCCTGACAGG - Intronic
1142190632 16:88715748-88715770 GTTCGAGGAGCTGCCGTGCGTGG - Exonic
1142285748 16:89170867-89170889 GTTCCCCGAGGCCCCCTGCCTGG - Intergenic
1142569665 17:864970-864992 GATCCAGGAGCCTGACTGCCAGG - Intronic
1142605164 17:1077517-1077539 GTTCCTGCAGCCGCCCTGCTGGG + Intronic
1142799799 17:2337855-2337877 CGTCCAGGACCCGCCCCGCCCGG - Intronic
1143734448 17:8900674-8900696 GCTCCAGCTGCTGCCCTGCCTGG + Intronic
1144958657 17:19032721-19032743 GTTCCAGGAGCCACTCAGCCAGG + Intronic
1144976502 17:19141803-19141825 GTTCCAGGAGCCACTCAGCCAGG - Intronic
1145273169 17:21415280-21415302 GTTGCAGGAGCCGCCCTGCCTGG + Exonic
1145311361 17:21702724-21702746 GTTCCAGGAGCCGCCCTGCCTGG + Exonic
1146353128 17:32112585-32112607 GTTCATGGCGCCGCCCTGCTGGG + Intergenic
1146936907 17:36817756-36817778 ATTCTAGAAGCCTCCCTGCCTGG + Intergenic
1148157491 17:45432223-45432245 TTTCCCGGAGCAGCCCGGCCGGG + Intronic
1148456536 17:47814331-47814353 GTTCCAGGAGCAGCTCTGCTGGG - Intronic
1148463562 17:47851402-47851424 GTTCTAAGACCCGCCCCGCCGGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1151267787 17:72969890-72969912 GTTCCAGGGGCTGGCCTGCCAGG - Intronic
1151965008 17:77426549-77426571 GTTCCAGGAGCAGCCAGGCCAGG - Intronic
1152655618 17:81517975-81517997 GTTGCAGGACGCGCACTGCCAGG - Intronic
1156485776 18:37464677-37464699 GGTCATGGAGCAGCCCTGCCAGG + Intronic
1160319833 18:77879985-77880007 GCCCCAGGAGCTGCTCTGCCCGG - Intergenic
1160500048 18:79396869-79396891 GGTCCAGGAGCCGGCGTGACGGG - Intronic
1160532144 18:79571788-79571810 GCTCCAGGAGCTGCCCTGTCAGG + Intergenic
1160826566 19:1082980-1083002 GCTCCCGCAGCCGACCTGCCAGG - Exonic
1161080156 19:2306558-2306580 GTTACGGCAGCAGCCCTGCCTGG - Intronic
1161143686 19:2664455-2664477 GTTCCAGGTCACGCCCGGCCTGG - Intronic
1161305551 19:3565501-3565523 GTTCCAGGCCCTGCCGTGCCAGG - Intronic
1161391930 19:4025563-4025585 GTTCCTGGGGCCTCCCAGCCTGG + Intronic
1161505855 19:4643003-4643025 ATTACATGAGCCACCCTGCCTGG - Intronic
1161531487 19:4792556-4792578 CATCCAGGAGCAGCCCGGCCAGG + Exonic
1162461267 19:10815739-10815761 GCCCCTGGAGCCGCCCTGCCTGG + Intronic
1162779336 19:12998507-12998529 GCTCCAGGAACCGCCCCACCCGG - Intronic
1163010178 19:14420176-14420198 ATTACATGAGCCACCCTGCCTGG + Intergenic
1163462790 19:17448742-17448764 GTGCCAGGCCCCGCCCCGCCAGG - Intronic
1163505521 19:17703813-17703835 GTTCCAGGCCCTGCCCTGCAGGG + Intergenic
1166354120 19:42217136-42217158 GGTGCGGGAGCGGCCCTGCCCGG - Intronic
1167590548 19:50402278-50402300 GTTCCAGGAGACGGCGGGCCGGG - Exonic
1168671336 19:58243557-58243579 GTTCCCTGCGCCGCCCTGCTGGG + Intronic
925132424 2:1503250-1503272 CTTCCAGGAGCTGCTCTGTCTGG - Intronic
925293559 2:2763740-2763762 GTTCCAGGTGCAGACATGCCCGG - Intergenic
925444694 2:3917811-3917833 GGTCTCGGAGCCGGCCTGCCTGG + Intergenic
927683717 2:25156635-25156657 GGTGCAGGAGCCTCCATGCCTGG - Exonic
931444240 2:62313663-62313685 GTTCCAGGAGAAGCACAGCCAGG - Intergenic
931996729 2:67845887-67845909 GGTCCAGGGGAAGCCCTGCCAGG + Intergenic
932093221 2:68825035-68825057 GTGCCAGGTGGCCCCCTGCCAGG - Intronic
932152716 2:69387436-69387458 GTTCCTGGAGACGCCCGCCCCGG + Intergenic
934588462 2:95526451-95526473 GCTCCTGGAGCGCCCCTGCCGGG + Intergenic
934782824 2:96983152-96983174 ATTCCATGAGCCACCATGCCTGG + Intronic
935216973 2:100982335-100982357 GATCCAGGAGCAGCTCTGCCTGG + Exonic
935331823 2:101982903-101982925 GCTCCATGAGCTTCCCTGCCCGG - Intergenic
940913571 2:159229983-159230005 GCTGCAGGAGCAGCCCTGGCTGG - Exonic
943669682 2:190648434-190648456 GGTCCAGGTGCGCCCCTGCCCGG - Intronic
944784763 2:203058105-203058127 GTTCTGGGAGCCACCGTGCCCGG + Intronic
947399097 2:229714532-229714554 GCTGCAGGAGGCGCCCGGCCCGG - Exonic
947749685 2:232525779-232525801 CTTCCAGAGGCAGCCCTGCCTGG - Intergenic
948355119 2:237371816-237371838 CTTCCGGGAGCTGCCCAGCCTGG - Exonic
948625040 2:239263498-239263520 GTGCCAAGAGCTGCCCTGCCTGG - Intronic
948824673 2:240568461-240568483 GCGCCGGGAGCCGCCCGGCCCGG - Intronic
1170117115 20:12872498-12872520 GATCCAGGAACCCCCCTGCAAGG + Intergenic
1173643050 20:44616823-44616845 GTTCCAGGCGCCACCCCGCTGGG + Intronic
1176369783 21:6055811-6055833 GAACCAGGAGCCCCCGTGCCGGG - Intergenic
1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1176832784 21:13763027-13763049 CATCCAGGAGCAGCCCGGCCAGG + Intergenic
1179021662 21:37646566-37646588 GTTCCAGCAGCCGGTGTGCCGGG + Intronic
1179628123 21:42660001-42660023 GTTCCTGCCGCCTCCCTGCCCGG - Intronic
1179753736 21:43482730-43482752 GAACCAGGAGCCCCCGTGCCGGG + Intergenic
1179988909 21:44935709-44935731 CTTGCAGGTGACGCCCTGCCTGG - Exonic
1180089664 21:45527453-45527475 CCTCCAGGGCCCGCCCTGCCTGG - Intronic
1180089683 21:45527519-45527541 CCTCCAGGGCCCGCCCTGCCCGG - Intronic
1180089712 21:45527618-45527640 CCTCCAGGGCCCGCCCTGCCTGG - Intronic
1180089730 21:45527684-45527706 CCTCCAGGGCCCGCCCTGCCTGG - Intronic
1180089759 21:45527783-45527805 CCTCCAGGGCCCGCCCTGCCTGG - Intronic
1180465009 22:15603267-15603289 GTGCCCGCAGCCGCCCTTCCCGG - Intergenic
1182118981 22:27774811-27774833 GTGCCAGGGGCAGCTCTGCCAGG + Intronic
1182659274 22:31913819-31913841 GTACCTGGAGCCACCATGCCTGG + Intergenic
1182981489 22:34675523-34675545 GTTCCAGGAGCAGCTCCTCCAGG - Intergenic
1183322769 22:37175353-37175375 GGACCCTGAGCCGCCCTGCCTGG + Intergenic
1184046690 22:41976661-41976683 GGTCCAGGAGCCGCCCCCGCGGG - Intronic
1184204558 22:42993780-42993802 GTCCCTGGTGCCGCCCTTCCAGG - Intronic
1184476491 22:44724911-44724933 GTTGCAGGCCCAGCCCTGCCAGG + Intronic
1185045853 22:48528413-48528435 GTTGCAGGGGCTGCCCTTCCAGG - Intronic
1185231761 22:49687789-49687811 GCTCCAGGAGCAGCCCAGGCTGG - Intergenic
950158940 3:10744254-10744276 GAACCGGCAGCCGCCCTGCCTGG - Intergenic
950451183 3:13066725-13066747 TATCCAGGAGCCGCTCTGGCAGG + Intronic
953404854 3:42655044-42655066 GGCGCTGGAGCCGCCCTGCCTGG + Intronic
960948487 3:122983047-122983069 CATCCCGCAGCCGCCCTGCCTGG - Intronic
961416726 3:126764620-126764642 TTTGCAGGAGCCGCCCTGGGCGG - Intronic
964326605 3:155553382-155553404 GCTACAGGAGCCACCGTGCCCGG + Intronic
968267024 3:197370194-197370216 GTTAAAGGAGCCACCGTGCCTGG + Intergenic
969169604 4:5349166-5349188 GGTCCAAGAGCTGGCCTGCCTGG + Intronic
969525741 4:7703202-7703224 CTCCCAGGAGCCGCTCAGCCTGG + Intronic
971207450 4:24584226-24584248 GCTCCAGGACCCGCTCGGCCAGG + Intronic
972939675 4:44181718-44181740 ATGCCAGGAGCCCCTCTGCCCGG + Intronic
975261226 4:72301992-72302014 GTGCCAGGCTCAGCCCTGCCTGG - Intronic
978393063 4:108247890-108247912 GTTCCTAGAGCCGCCTTGGCAGG - Intergenic
978777220 4:112516096-112516118 GTGCCAGGAGCCGCACGGCCAGG - Exonic
979855807 4:125632616-125632638 GAACCAGGAGCCCACCTGCCTGG + Intergenic
981093893 4:140759124-140759146 GTGCCAGAAGCCACCATGCCCGG + Intergenic
981647804 4:147019910-147019932 GGTCCCGGGGCCGCACTGCCTGG - Intergenic
984702355 4:182826420-182826442 GTCCCAGGGGCAACCCTGCCAGG + Intergenic
984881494 4:184413505-184413527 ACTCCAGTAGCAGCCCTGCCAGG + Intronic
985650193 5:1104023-1104045 GTAACAGGAGCCGCCCTGGGAGG - Intronic
985965093 5:3333384-3333406 GTCCCAGGAGCAGCCCTGGATGG - Intergenic
986706731 5:10459264-10459286 ATTCCAGCAGCCTCCTTGCCAGG + Intronic
987362803 5:17122093-17122115 CTCACAGGAGCCCCCCTGCCTGG + Intronic
993467001 5:88260708-88260730 CTTCCATGAGCCACCATGCCAGG + Intronic
994420545 5:99524040-99524062 GCTGCAGGAGCCGACGTGCCAGG + Intergenic
996738258 5:126776889-126776911 GGTCCGGGAACCGCCCAGCCGGG + Intronic
997235915 5:132271800-132271822 GTTCCGGGGGCCGCCAGGCCCGG - Exonic
998177783 5:139912375-139912397 GTCCCAGGAGCAGCCAAGCCTGG - Intronic
1000311811 5:160052228-160052250 ATTACAGGAGCCACCGTGCCTGG - Intronic
1001055304 5:168444606-168444628 GCCCCAGGAGCTGCCCTGCCTGG + Intronic
1001143918 5:169167718-169167740 GTACCAGAAGCCAGCCTGCCTGG - Intronic
1001399775 5:171439571-171439593 GTTCCAGCTGCAGCTCTGCCAGG + Intronic
1002093354 5:176817385-176817407 GTTCCACCTGCCGCCCTGGCTGG - Intronic
1002279764 5:178123424-178123446 GTTCCCTGAGCTGCCCTGTCAGG - Exonic
1002574074 5:180161663-180161685 GTTCCAGGAGCCGCGGGGCTGGG - Intronic
1003187943 6:3849297-3849319 GTTTCCGCAGCCGCCCTACCAGG + Intergenic
1003546935 6:7067038-7067060 GTTCAAGCAGCCCTCCTGCCTGG + Intergenic
1003853692 6:10251110-10251132 TTTCCAGGAGCAGTCCTGGCTGG - Intergenic
1005549276 6:26897760-26897782 GCTGCAGGAGCCGACGTGCCAGG - Intergenic
1005549453 6:26898577-26898599 GCTGCAGGAGCCGACGTGCCAGG - Intergenic
1005549629 6:26899397-26899419 GCTGCAGGAGCCGACGTGCCAGG - Intergenic
1006030301 6:31172706-31172728 GCTCCAGGCTCAGCCCTGCCTGG + Intronic
1006168847 6:32081617-32081639 GTTCCTGGAGCAGCCCCTCCTGG - Intronic
1006400544 6:33814736-33814758 CTGCCAGGAGCAGCCCTACCGGG + Intergenic
1009020017 6:57938870-57938892 GCTGCAGGAGCCGACGTGCCAGG - Intergenic
1011274659 6:85618401-85618423 GTTACAGGCGCCACCATGCCTGG - Intronic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1014990006 6:128062953-128062975 GTGCCAGGAGCCACCGTGTCTGG + Intronic
1015283287 6:131457047-131457069 GTTCCAGGAGCCACACTGAGCGG + Intergenic
1017324780 6:153131667-153131689 CACCCAGGAGCCGGCCTGCCAGG + Intergenic
1017914288 6:158819396-158819418 GTCCCGGGACCCGCCCCGCCGGG - Exonic
1018304606 6:162442278-162442300 GACCCAGGAGCCCCCCTGCGCGG + Intronic
1018740627 6:166725812-166725834 CCGCCAGGAGCCTCCCTGCCCGG - Intronic
1019024185 6:168943357-168943379 GATTCAGGAGCTGCCCTGCTGGG - Intergenic
1019272599 7:158814-158836 GTTCCAGCAGCCACGCTGGCAGG - Intergenic
1019717659 7:2547440-2547462 GCTGCAGGAGCACCCCTGCCTGG - Exonic
1026737826 7:72960191-72960213 GTTCCAGGAGCTGCGCCACCCGG - Exonic
1026788860 7:73318992-73319014 GTTCCAGGAGCTGCACCACCTGG - Exonic
1027019138 7:74799117-74799139 ATTACAGGAGCCACCGTGCCAGG + Intronic
1027068889 7:75146822-75146844 ATTACAGGAGCCACCGTGCCAGG - Intronic
1027105908 7:75404877-75404899 GTTCCAGGAGCTGCGCCACCCGG + Exonic
1029118094 7:98248272-98248294 GATCTAGGAGCCGCCCTGTCGGG - Intronic
1035106188 7:156443369-156443391 GTGCCAGGTGCTGGCCTGCCTGG + Intergenic
1035181097 7:157090270-157090292 CTTCCAGGAGCCTAGCTGCCTGG - Intergenic
1035731065 8:1853824-1853846 GTTCCTGCAGCTGCACTGCCAGG + Intronic
1039481176 8:37874628-37874650 GTTCAGGGAGCTGCCCTGTCTGG + Exonic
1039843208 8:41308324-41308346 GTCCCCGGAGCCGCTCTTCCTGG - Intronic
1044657633 8:94565027-94565049 TTTGCAGGAGCCATCCTGCCAGG - Intergenic
1048770637 8:137891022-137891044 ATTCTAGGATCGGCCCTGCCAGG + Intergenic
1049337193 8:142092683-142092705 GTTCCTGCAGCCTCCCTGCTGGG - Intergenic
1049818945 8:144622495-144622517 GTGCCCGGAGCCGCCCTCCCAGG + Intergenic
1055080042 9:72259576-72259598 GTTCCTGGAGCCGCTGTGCAGGG + Intergenic
1056089985 9:83195949-83195971 ATCCCAGGAGCCGCCCAGCTGGG - Intergenic
1057785955 9:98087517-98087539 GTTCCAGGAGCCGCTCTACCCGG - Exonic
1057793726 9:98141263-98141285 GCTCCAGGTACCGCCCTGCCAGG - Intronic
1059701684 9:116781111-116781133 ATTACATGAGCCACCCTGCCTGG + Intronic
1060938938 9:127532328-127532350 GTTCTGGGAGCCACCATGCCTGG - Intronic
1062541636 9:137044215-137044237 GTTCCAGCAGCCGCAGTGGCAGG + Intronic
1062579436 9:137222827-137222849 GTGCCAGGGGCCACCCTGTCCGG - Intergenic
1203731795 Un_GL000216v2:98542-98564 GTCCCTGGAGCCCCCCTGACGGG - Intergenic
1191059915 X:56284334-56284356 TTTCCAGGAGCAGCCATCCCAGG - Exonic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1192223092 X:69210664-69210686 CCTCCAAGAGCTGCCCTGCCAGG + Intergenic
1194935036 X:99938665-99938687 TTTGCAGGAGCCGCCCTGGGCGG - Intergenic
1195693963 X:107653051-107653073 GTAGCAGGAGCAGACCTGCCAGG + Intergenic
1199973841 X:152879851-152879873 GTGCCAGGAGCAGATCTGCCTGG - Intergenic