ID: 1145313355

View in Genome Browser
Species Human (GRCh38)
Location 17:21712877-21712899
Sequence CAGAGCCCAGTCCCAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145313352_1145313355 -2 Left 1145313352 17:21712856-21712878 CCATTTAAAAAGGACAAAAATCA No data
Right 1145313355 17:21712877-21712899 CAGAGCCCAGTCCCAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145313355 Original CRISPR CAGAGCCCAGTCCCAGGCCT GGG Intergenic
No off target data available for this crispr