ID: 1145313398

View in Genome Browser
Species Human (GRCh38)
Location 17:21713070-21713092
Sequence GAGAACATGGGGCAGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145313388_1145313398 17 Left 1145313388 17:21713030-21713052 CCAGAACATTCATGCTAAGGGAG No data
Right 1145313398 17:21713070-21713092 GAGAACATGGGGCAGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145313398 Original CRISPR GAGAACATGGGGCAGGTGAC TGG Intergenic
No off target data available for this crispr