ID: 1145314690

View in Genome Browser
Species Human (GRCh38)
Location 17:21722672-21722694
Sequence ATGGAAGATGAGGAAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314690_1145314697 21 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314697 17:21722716-21722738 TCCTCACTCACCACAGTCATGGG No data
1145314690_1145314696 20 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data
1145314690_1145314699 22 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314699 17:21722717-21722739 CCTCACTCACCACAGTCATGGGG No data
1145314690_1145314700 23 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314690 Original CRISPR ATGGAAGATGAGGAAGGAAT TGG (reversed) Intergenic