ID: 1145314691

View in Genome Browser
Species Human (GRCh38)
Location 17:21722678-21722700
Sequence TGAGAGATGGAAGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314691_1145314700 17 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314691_1145314696 14 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data
1145314691_1145314699 16 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314699 17:21722717-21722739 CCTCACTCACCACAGTCATGGGG No data
1145314691_1145314697 15 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314697 17:21722716-21722738 TCCTCACTCACCACAGTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314691 Original CRISPR TGAGAGATGGAAGATGAGGA AGG (reversed) Intergenic