ID: 1145314692

View in Genome Browser
Species Human (GRCh38)
Location 17:21722682-21722704
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314692_1145314699 12 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314699 17:21722717-21722739 CCTCACTCACCACAGTCATGGGG No data
1145314692_1145314697 11 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314697 17:21722716-21722738 TCCTCACTCACCACAGTCATGGG No data
1145314692_1145314700 13 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314692_1145314696 10 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314692 Original CRISPR GAATTGAGAGATGGAAGATG AGG (reversed) Intergenic