ID: 1145314694

View in Genome Browser
Species Human (GRCh38)
Location 17:21722704-21722726
Sequence GTGAGTGAGGAGGAAGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314694_1145314699 -10 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314699 17:21722717-21722739 CCTCACTCACCACAGTCATGGGG No data
1145314694_1145314703 28 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314703 17:21722755-21722777 TCCTAAGACTCCCCTCTCCCGGG No data
1145314694_1145314705 29 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314705 17:21722756-21722778 CCTAAGACTCCCCTCTCCCGGGG No data
1145314694_1145314702 27 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314702 17:21722754-21722776 TTCCTAAGACTCCCCTCTCCCGG No data
1145314694_1145314700 -9 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314694 Original CRISPR GTGAGTGAGGAGGAAGAATG TGG (reversed) Intergenic