ID: 1145314696

View in Genome Browser
Species Human (GRCh38)
Location 17:21722715-21722737
Sequence CTCCTCACTCACCACAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314691_1145314696 14 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data
1145314692_1145314696 10 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data
1145314690_1145314696 20 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data
1145314693_1145314696 1 Left 1145314693 17:21722691-21722713 CCATCTCTCAATTCCACATTCTT No data
Right 1145314696 17:21722715-21722737 CTCCTCACTCACCACAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314696 Original CRISPR CTCCTCACTCACCACAGTCA TGG Intergenic