ID: 1145314700

View in Genome Browser
Species Human (GRCh38)
Location 17:21722718-21722740
Sequence CTCACTCACCACAGTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145314693_1145314700 4 Left 1145314693 17:21722691-21722713 CCATCTCTCAATTCCACATTCTT No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314694_1145314700 -9 Left 1145314694 17:21722704-21722726 CCACATTCTTCCTCCTCACTCAC No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314692_1145314700 13 Left 1145314692 17:21722682-21722704 CCTCATCTTCCATCTCTCAATTC No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314690_1145314700 23 Left 1145314690 17:21722672-21722694 CCAATTCCTTCCTCATCTTCCAT No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data
1145314691_1145314700 17 Left 1145314691 17:21722678-21722700 CCTTCCTCATCTTCCATCTCTCA No data
Right 1145314700 17:21722718-21722740 CTCACTCACCACAGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145314700 Original CRISPR CTCACTCACCACAGTCATGG GGG Intergenic