ID: 1145316612

View in Genome Browser
Species Human (GRCh38)
Location 17:21738909-21738931
Sequence CAGGCTTCTGCGCTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145316612_1145316621 8 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316621 17:21738940-21738962 GGATACTGGGAAATGACCTGAGG No data
1145316612_1145316618 -6 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316618 17:21738926-21738948 AGCCTGAGGGCAAAGGATACTGG No data
1145316612_1145316619 -5 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316619 17:21738927-21738949 GCCTGAGGGCAAAGGATACTGGG No data
1145316612_1145316628 29 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316628 17:21738961-21738983 GGGTCAGAGCAGGGGCCCATGGG No data
1145316612_1145316623 19 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316623 17:21738951-21738973 AATGACCTGAGGGTCAGAGCAGG No data
1145316612_1145316629 30 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316629 17:21738962-21738984 GGTCAGAGCAGGGGCCCATGGGG No data
1145316612_1145316624 20 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316624 17:21738952-21738974 ATGACCTGAGGGTCAGAGCAGGG No data
1145316612_1145316622 9 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316622 17:21738941-21738963 GATACTGGGAAATGACCTGAGGG No data
1145316612_1145316625 21 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316625 17:21738953-21738975 TGACCTGAGGGTCAGAGCAGGGG No data
1145316612_1145316627 28 Left 1145316612 17:21738909-21738931 CCACCACCAAGCGCAGAAGCCTG No data
Right 1145316627 17:21738960-21738982 AGGGTCAGAGCAGGGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145316612 Original CRISPR CAGGCTTCTGCGCTTGGTGG TGG (reversed) Intergenic
No off target data available for this crispr