ID: 1145318255

View in Genome Browser
Species Human (GRCh38)
Location 17:21747879-21747901
Sequence CAATCTCCTCCCTGTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145318255_1145318263 20 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318263 17:21747922-21747944 TCAAGGCCTCATCTCCATCAGGG No data
1145318255_1145318264 21 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318264 17:21747923-21747945 CAAGGCCTCATCTCCATCAGGGG No data
1145318255_1145318261 3 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318261 17:21747905-21747927 TTTCAAGGGGGCAGAACTCAAGG No data
1145318255_1145318260 -9 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318260 17:21747893-21747915 AGGAGATTGAGCTTTCAAGGGGG No data
1145318255_1145318259 -10 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318259 17:21747892-21747914 GAGGAGATTGAGCTTTCAAGGGG No data
1145318255_1145318262 19 Left 1145318255 17:21747879-21747901 CCCATTTCACAGGGAGGAGATTG No data
Right 1145318262 17:21747921-21747943 CTCAAGGCCTCATCTCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145318255 Original CRISPR CAATCTCCTCCCTGTGAAAT GGG (reversed) Intergenic
No off target data available for this crispr