ID: 1145319845

View in Genome Browser
Species Human (GRCh38)
Location 17:21758539-21758561
Sequence GAGCCGTGAAGTTAGAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145319843_1145319845 22 Left 1145319843 17:21758494-21758516 CCTATTTTTTAACACTTCACAAA No data
Right 1145319845 17:21758539-21758561 GAGCCGTGAAGTTAGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145319845 Original CRISPR GAGCCGTGAAGTTAGAAAAG TGG Intergenic
No off target data available for this crispr