ID: 1145319898

View in Genome Browser
Species Human (GRCh38)
Location 17:21759375-21759397
Sequence CTTTACCCCTTTAATAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145319898_1145319904 29 Left 1145319898 17:21759375-21759397 CCCACATTATTAAAGGGGTAAAG No data
Right 1145319904 17:21759427-21759449 AAACTGATGTTCAAGTATAAGGG No data
1145319898_1145319903 28 Left 1145319898 17:21759375-21759397 CCCACATTATTAAAGGGGTAAAG No data
Right 1145319903 17:21759426-21759448 CAAACTGATGTTCAAGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145319898 Original CRISPR CTTTACCCCTTTAATAATGT GGG (reversed) Intergenic
No off target data available for this crispr