ID: 1145327839

View in Genome Browser
Species Human (GRCh38)
Location 17:21845943-21845965
Sequence TATTATCTTTAGAAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145327837_1145327839 7 Left 1145327837 17:21845913-21845935 CCCACTGGGGCTATTAAGGTAGT No data
Right 1145327839 17:21845943-21845965 TATTATCTTTAGAAGTTTTATGG No data
1145327838_1145327839 6 Left 1145327838 17:21845914-21845936 CCACTGGGGCTATTAAGGTAGTT No data
Right 1145327839 17:21845943-21845965 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145327839 Original CRISPR TATTATCTTTAGAAGTTTTA TGG Intergenic
No off target data available for this crispr