ID: 1145335485

View in Genome Browser
Species Human (GRCh38)
Location 17:21908910-21908932
Sequence TGGAATGGTCTCATATAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145335481_1145335485 -3 Left 1145335481 17:21908890-21908912 CCAAATTCAATGGACTCAAATGG No data
Right 1145335485 17:21908910-21908932 TGGAATGGTCTCATATAGAAGGG No data
1145335480_1145335485 -2 Left 1145335480 17:21908889-21908911 CCCAAATTCAATGGACTCAAATG No data
Right 1145335485 17:21908910-21908932 TGGAATGGTCTCATATAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145335485 Original CRISPR TGGAATGGTCTCATATAGAA GGG Intergenic
No off target data available for this crispr