ID: 1145346390

View in Genome Browser
Species Human (GRCh38)
Location 17:22044562-22044584
Sequence GGCCGCCTGAACCTCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145346390_1145346398 20 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346398 17:22044605-22044627 GAGTGATGCCTCCTTGGTGCCGG No data
1145346390_1145346401 25 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346401 17:22044610-22044632 ATGCCTCCTTGGTGCCGGAGGGG No data
1145346390_1145346400 24 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346400 17:22044609-22044631 GATGCCTCCTTGGTGCCGGAGGG No data
1145346390_1145346399 23 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346399 17:22044608-22044630 TGATGCCTCCTTGGTGCCGGAGG No data
1145346390_1145346393 -7 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346393 17:22044578-22044600 GGCGGCCCCGGTGTCGCAAGCGG No data
1145346390_1145346397 14 Left 1145346390 17:22044562-22044584 CCCTGGCGGAGGTTCAGGCGGCC No data
Right 1145346397 17:22044599-22044621 GGCTGTGAGTGATGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145346390 Original CRISPR GGCCGCCTGAACCTCCGCCA GGG (reversed) Intergenic
No off target data available for this crispr