ID: 1145351599

View in Genome Browser
Species Human (GRCh38)
Location 17:22089130-22089152
Sequence TCCAGCTGGCCAGGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145351592_1145351599 -7 Left 1145351592 17:22089114-22089136 CCGGCCCCTGGCCAAGTCCAGCT No data
Right 1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG No data
1145351588_1145351599 24 Left 1145351588 17:22089083-22089105 CCTGGGGTGGGAGTAAGTGCCTT No data
Right 1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG No data
1145351590_1145351599 5 Left 1145351590 17:22089102-22089124 CCTTTACTGAAACCGGCCCCTGG No data
Right 1145351599 17:22089130-22089152 TCCAGCTGGCCAGGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145351599 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG Intergenic
No off target data available for this crispr