ID: 1145351748

View in Genome Browser
Species Human (GRCh38)
Location 17:22090003-22090025
Sequence CAGTATAGCCCCAGATAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1145351736_1145351748 2 Left 1145351736 17:22089978-22090000 CCCCCACCCACCCTGCCACCACG No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351735_1145351748 3 Left 1145351735 17:22089977-22089999 CCCCCCACCCACCCTGCCACCAC No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351744_1145351748 -8 Left 1145351744 17:22089988-22090010 CCCTGCCACCACGGGCAGTATAG No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351737_1145351748 1 Left 1145351737 17:22089979-22090001 CCCCACCCACCCTGCCACCACGG No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351745_1145351748 -9 Left 1145351745 17:22089989-22090011 CCTGCCACCACGGGCAGTATAGC No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351739_1145351748 0 Left 1145351739 17:22089980-22090002 CCCACCCACCCTGCCACCACGGG No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351741_1145351748 -1 Left 1145351741 17:22089981-22090003 CCACCCACCCTGCCACCACGGGC No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351742_1145351748 -4 Left 1145351742 17:22089984-22090006 CCCACCCTGCCACCACGGGCAGT No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351734_1145351748 6 Left 1145351734 17:22089974-22089996 CCTCCCCCCACCCACCCTGCCAC No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data
1145351743_1145351748 -5 Left 1145351743 17:22089985-22090007 CCACCCTGCCACCACGGGCAGTA No data
Right 1145351748 17:22090003-22090025 CAGTATAGCCCCAGATAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1145351748 Original CRISPR CAGTATAGCCCCAGATAGCC AGG Intergenic
No off target data available for this crispr